Incidental Mutation 'R3710:Col9a2'
ID259530
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Namecollagen, type IX, alpha 2
SynonymsCol9a-2
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3710 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location121039385-121055322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 121054258 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 599 (R599G)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
Predicted Effect probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Meta Mutation Damage Score 0.3183 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
gravity_wave UTSW 4 121044019 critical splice donor site probably null
R0208:Col9a2 UTSW 4 121052288 splice site probably benign
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1023:Col9a2 UTSW 4 121044010 missense unknown
R1657:Col9a2 UTSW 4 121040974 missense unknown
R1724:Col9a2 UTSW 4 121053902 missense probably damaging 1.00
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2223:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2393:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
R7571:Col9a2 UTSW 4 121039784 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCTTGGTACATAGTAAATGCCAG -3'
(R):5'- AATGCCAGGCTTCCACAAAG -3'

Sequencing Primer
(F):5'- GCCAGTTATGTATTGGACAATTTCC -3'
(R):5'- GAAAGCCCAGATGCCCATGG -3'
Posted On2015-01-23