Incidental Mutation 'R3711:Klhdc4'
ID259609
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
MMRRC Submission 040704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R3711 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121798055 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 378 (V378A)
Ref Sequence ENSEMBL: ENSMUSP00000134361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000167439] [ENSMUST00000174192] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect probably benign
Transcript: ENSMUST00000045884
AA Change: V409A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: V409A

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167439
SMART Domains Protein: ENSMUSP00000126190
Gene: ENSMUSG00000025318

DomainStartEndE-ValueType
MORN 13 34 8.01e-1 SMART
MORN 37 57 6.13e1 SMART
MORN 59 80 2.99e-1 SMART
Pfam:MORN 83 104 5.8e-2 PFAM
MORN 105 126 8.1e-5 SMART
MORN 128 149 2.74e-2 SMART
low complexity region 181 192 N/A INTRINSIC
low complexity region 212 244 N/A INTRINSIC
MORN 286 307 2.78e-3 SMART
MORN 309 330 1.03e-6 SMART
low complexity region 360 381 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172954
Predicted Effect probably benign
Transcript: ENSMUST00000174192
AA Change: V352A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: V352A

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174206
Predicted Effect probably benign
Transcript: ENSMUST00000174665
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174709
Predicted Effect probably benign
Transcript: ENSMUST00000174717
AA Change: V378A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,946,255 V1138A possibly damaging Het
Adgrv1 A T 13: 81,419,475 I5193K probably benign Het
Adnp A T 2: 168,184,823 I184N probably damaging Het
Ahnak T G 19: 9,007,898 V2182G probably benign Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Aspm G A 1: 139,458,100 G494D probably benign Het
Atic T A 1: 71,578,579 S563T probably benign Het
Bahcc1 A T 11: 120,275,097 I1060F probably benign Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Dnm2 C A 9: 21,506,373 probably benign Het
Exo1 A G 1: 175,893,829 T345A probably benign Het
Fbf1 T C 11: 116,161,473 H53R possibly damaging Het
Fbf1 A G 11: 116,163,353 I29T probably damaging Het
Gm14399 G A 2: 175,131,510 R151* probably null Het
Gsdma T A 11: 98,666,219 Y53* probably null Het
Hid1 A T 11: 115,358,775 L208Q probably damaging Het
Kif4-ps A G 12: 101,146,053 E147G probably damaging Het
Kif7 A T 7: 79,710,892 V245D probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mast3 C A 8: 70,779,607 R1242L probably benign Het
Mettl7a3 A T 15: 100,335,080 M51L probably benign Het
Mon1b T C 8: 113,639,147 M369T possibly damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Narf G T 11: 121,246,938 E224* probably null Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nmnat3 T A 9: 98,410,223 Y108N probably damaging Het
Npr2 A T 4: 43,643,378 Y534F probably benign Het
Obox5 A T 7: 15,758,788 M223L probably benign Het
Olfr1132 T C 2: 87,635,681 D22G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr365 A G 2: 37,201,273 T11A probably benign Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Optc A T 1: 133,905,081 S94T probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Stab2 A G 10: 86,866,708 L423P probably damaging Het
Sun5 A G 2: 153,867,548 V74A probably benign Het
Tanc2 A G 11: 105,798,690 Y226C probably damaging Het
Tlr6 T C 5: 64,953,809 D585G possibly damaging Het
Tnrc6c A G 11: 117,723,124 T863A probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Ythdc2 C T 18: 44,833,173 L159F probably damaging Het
Zc3h6 A G 2: 129,017,331 N1094S probably benign Het
Zdbf2 T C 1: 63,308,671 S2070P possibly damaging Het
Zfp648 T A 1: 154,204,558 S154R probably benign Het
Zfp748 A G 13: 67,540,796 C782R probably damaging Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
R7716:Klhdc4 UTSW 8 121829420 missense unknown
R8430:Klhdc4 UTSW 8 121799513 missense possibly damaging 0.82
R8841:Klhdc4 UTSW 8 121796641 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCGGATCCATCTCCACCAAG -3'
(R):5'- GCCCCAAGTCTGAGAAGAAG -3'

Sequencing Primer
(F):5'- CCATCTTGTGAAGGTCAAGGC -3'
(R):5'- CCCCAAGTCTGAGAAGAAGAAACG -3'
Posted On2015-01-23