Mutagenetix > Incidental Mutation

Incidental Mutation 'R2901:Nme8'

261480

Institutional Source

Beutler Lab

Gene Symbol

Nme8

Ensembl Gene

ENSMUSG00000041138

Gene Name

NME/NM23 family member 8

Synonyms

Sptrx-2, 1700056P15Rik, Txndc3

MMRRC Submission

040489-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R2901 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19645078-19697794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19675664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 23 (V23E)

Ref Sequence

ENSEMBL: ENSMUSP00000152780 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763] [ENSMUST00000223466]

AlphaFold

Q715T0

Predicted Effect

probably benign
Transcript: ENSMUST00000039340
AA Change: V262E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138
AA Change: V262E

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	11	112	3.7e-12	PFAM
Pfam:NDK	155	283	2.3e-14	PFAM
NDK	312	452	3.8e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091763
AA Change: V262E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138
AA Change: V262E

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	11	112	6.9e-12	PFAM
Pfam:NDK	155	284	1.1e-13	PFAM
NDK	312	449	2.75e-25	SMART
NDK	450	586	1.45e-33	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144820

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220524

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223286

Predicted Effect

probably benign
Transcript: ENSMUST00000223466
AA Change: V23E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933406M09Rik	T	C	1: 134,390,924	L478P	probably damaging	Het
Abhd13	T	A	8: 9,988,231	M276K	probably damaging	Het
Angpt4	G	T	2: 151,911,339	C3F	unknown	Het
C1qtnf1	A	G	11: 118,448,104		probably null	Het
Cep192	C	T	18: 67,869,441	R2236C	possibly damaging	Het
Cep68	A	G	11: 20,240,187	L275P	probably damaging	Het
Clvs1	A	G	4: 9,281,972	K139E	probably damaging	Het
Col25a1	A	T	3: 130,546,391	E351V	probably damaging	Het
Dnah7a	A	T	1: 53,427,872	L3611Q	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Gm3336	T	C	8: 70,720,626	S96P	possibly damaging	Het
Gm9845	T	A	3: 39,358,593		noncoding transcript	Het
Klf12	G	T	14: 99,900,146	F321L	probably damaging	Het
Klhl20	G	T	1: 161,109,552	C84*	probably null	Het
Krt23	T	C	11: 99,483,971	D260G	probably damaging	Het
Lpin1	T	C	12: 16,553,998	K578E	probably benign	Het
Mrc1	A	G	2: 14,328,543	H1345R	possibly damaging	Het
Olfr1490	C	T	19: 13,654,945	P167L	probably damaging	Het
Olfr954	T	A	9: 39,461,938	I169N	probably damaging	Het
Prf1	A	T	10: 61,300,319	N125Y	probably damaging	Het
Ptp4a1	T	C	1: 30,943,304	N142D	possibly damaging	Het
Simc1	G	A	13: 54,541,518		probably null	Het
Snai2	T	C	16: 14,705,983	S4P	possibly damaging	Het
Ssc4d	G	A	5: 135,964,663	P113L	possibly damaging	Het
Stmn2	A	G	3: 8,541,921	I34V	probably benign	Het
Tspoap1	C	T	11: 87,777,975	P1358L	probably benign	Het
Ubr3	T	C	2: 70,016,192	S1620P	possibly damaging	Het
Vps51	G	A	19: 6,076,438	R95W	probably damaging	Het
Zufsp	C	T	10: 33,927,612	R492Q	probably damaging	Het
Zufsp	T	C	10: 33,928,063	T472A	probably benign	Het

Other mutations in Nme8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01984:Nme8	APN	13	19688980	missense	probably damaging	1.00
IGL02272:Nme8	APN	13	19658826	missense	probably damaging	0.99
IGL02344:Nme8	APN	13	19674404	missense	possibly damaging	0.94
IGL02395:Nme8	APN	13	19677908	missense	possibly damaging	0.64
IGL02621:Nme8	APN	13	19675648	missense	probably damaging	1.00
IGL02645:Nme8	APN	13	19660585	missense	probably damaging	1.00
IGL02807:Nme8	APN	13	19675831	unclassified	probably benign
IGL03059:Nme8	APN	13	19652244	missense	possibly damaging	0.92
IGL03288:Nme8	APN	13	19696606	missense	possibly damaging	0.94
IGL03323:Nme8	APN	13	19688950	missense	probably benign	0.06
R0139:Nme8	UTSW	13	19677848	missense	probably benign	0.19
R0616:Nme8	UTSW	13	19690859	missense	probably benign	0.00
R0632:Nme8	UTSW	13	19658036	missense	probably damaging	0.96
R1233:Nme8	UTSW	13	19660512	missense	possibly damaging	0.71
R1288:Nme8	UTSW	13	19674449	missense	possibly damaging	0.87
R1305:Nme8	UTSW	13	19696907	missense	possibly damaging	0.90
R1773:Nme8	UTSW	13	19697036	start codon destroyed	probably damaging	1.00
R1942:Nme8	UTSW	13	19675808	missense	probably damaging	1.00
R1970:Nme8	UTSW	13	19652322	missense	probably damaging	1.00
R2012:Nme8	UTSW	13	19696883	missense	probably damaging	1.00
R2093:Nme8	UTSW	13	19650872	missense	probably damaging	1.00
R2392:Nme8	UTSW	13	19688943	critical splice donor site	probably null
R2436:Nme8	UTSW	13	19677859	missense	probably damaging	1.00
R2902:Nme8	UTSW	13	19675664	missense	probably benign	0.02
R4665:Nme8	UTSW	13	19674435	missense	probably damaging	1.00
R4751:Nme8	UTSW	13	19675638	critical splice donor site	probably null
R4785:Nme8	UTSW	13	19657930	missense	probably damaging	0.96
R5101:Nme8	UTSW	13	19690847	critical splice donor site	probably null
R5217:Nme8	UTSW	13	19696691	missense	probably damaging	1.00
R5251:Nme8	UTSW	13	19660625	missense	probably benign	0.33
R5356:Nme8	UTSW	13	19652299	missense	probably damaging	1.00
R5397:Nme8	UTSW	13	19694379	missense	probably damaging	1.00
R5624:Nme8	UTSW	13	19677868	missense	possibly damaging	0.94
R6679:Nme8	UTSW	13	19690970	splice site	probably null
R7040:Nme8	UTSW	13	19694328	missense	probably damaging	1.00
R7111:Nme8	UTSW	13	19675647	missense	probably benign	0.06
R7185:Nme8	UTSW	13	19677883	missense	probably damaging	1.00
R7670:Nme8	UTSW	13	19658829	missense	probably benign	0.01
R7685:Nme8	UTSW	13	19650975	missense	probably benign	0.00
R8108:Nme8	UTSW	13	19650960	missense	probably benign	0.00
R8331:Nme8	UTSW	13	19658866	missense	probably damaging	1.00
R8413:Nme8	UTSW	13	19674519	missense	probably benign	0.01
R8808:Nme8	UTSW	13	19675808	missense	probably damaging	1.00
R9227:Nme8	UTSW	13	19690214	missense	probably benign
R9230:Nme8	UTSW	13	19690214	missense	probably benign
R9422:Nme8	UTSW	13	19675748	missense	probably benign	0.01
Z1088:Nme8	UTSW	13	19688957	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GCAAGGAAGTTATGCCGTTTCTAAC -3'
(R):5'- GGAGCCTGAGGGAAAGTTTC -3'

Sequencing Primer
(F):5'- CTTTCTTGTCACAAACATTCAAGG -3'
(R):5'- AGCCTGAGGGAAAGTTTCTCATTTTC -3'

Posted On

2015-01-23