Mutagenetix > Incidental Mutation

Incidental Mutation 'R5397:Nme8'

429766

Institutional Source

Beutler Lab

Gene Symbol

Nme8

Ensembl Gene

ENSMUSG00000041138

Gene Name

NME/NM23 family member 8

Synonyms

Sptrx-2, 1700056P15Rik, Txndc3

MMRRC Submission

042968-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R5397 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19645078-19697794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19694379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 70 (D70G)

Ref Sequence

ENSEMBL: ENSMUSP00000089358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763]

AlphaFold

Q715T0

Predicted Effect

probably damaging
Transcript: ENSMUST00000039340
AA Change: D70G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138
AA Change: D70G

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	11	112	3.7e-12	PFAM
Pfam:NDK	155	283	2.3e-14	PFAM
NDK	312	452	3.8e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091763
AA Change: D70G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138
AA Change: D70G

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	11	112	6.9e-12	PFAM
Pfam:NDK	155	284	1.1e-13	PFAM
NDK	312	449	2.75e-25	SMART
NDK	450	586	1.45e-33	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144820

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223286

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	C	14: 8,243,803	T518A	probably benign	Het
Acvr1b	T	A	15: 101,198,964	V254D	probably damaging	Het
Adar	T	C	3: 89,735,319	I169T	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Arap1	A	T	7: 101,384,912	Q187L	possibly damaging	Het
Atad5	T	A	11: 80,111,493	M1037K	probably damaging	Het
Bsg	T	A	10: 79,708,795	W56R	probably damaging	Het
C1qtnf3	A	G	15: 10,978,541	T276A	probably damaging	Het
Capn2	A	G	1: 182,470,706	C665R	probably damaging	Het
Cast	A	G	13: 74,720,937	S248P	possibly damaging	Het
Cd68	C	T	11: 69,665,658	V108I	probably benign	Het
Cyp2d11	A	T	15: 82,392,078	W131R	probably damaging	Het
Dhx58	A	G	11: 100,703,920	V50A	probably damaging	Het
Fam124a	A	G	14: 62,606,389	S449G	probably benign	Het
Flnc	G	A	6: 29,441,161	M371I	possibly damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr149	A	G	3: 62,530,805	S644P	probably damaging	Het
Gucy1b1	G	A	3: 82,044,151	T274I	possibly damaging	Het
Kcnq5	A	G	1: 21,405,856	V541A	probably damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Lig4	G	T	8: 9,972,644	R379S	probably benign	Het
Map7	G	A	10: 20,273,321	R514Q	unknown	Het
Mertk	T	A	2: 128,771,464	F467I	possibly damaging	Het
Mettl4	A	T	17: 94,727,277	Y463*	probably null	Het
Npat	A	G	9: 53,570,474	N1161D	probably damaging	Het
Olfr1283	T	A	2: 111,368,940	C103S	probably benign	Het
Olfr616	T	A	7: 103,564,506	I258F	probably damaging	Het
Olfr813	T	C	10: 129,856,710	F64S	probably damaging	Het
Paxip1	A	T	5: 27,772,004		probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Plxnc1	T	C	10: 94,843,752	T923A	probably benign	Het
Pms1	T	A	1: 53,192,120	K857*	probably null	Het
Ppp1r9b	A	G	11: 95,002,110	E260G	probably damaging	Het
Prpf3	A	T	3: 95,853,579	S4T	probably benign	Het
Rdh14	T	A	12: 10,394,869	V240D	probably damaging	Het
Ripply1	TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT	TTCCTCCTCCTCCTCCTCCTCCTCCTCCT	X: 139,779,850		probably benign	Het
S100a1	A	T	3: 90,512,135	M1K	probably null	Het
Slc2a5	G	A	4: 150,139,823		probably null	Het
Slc5a5	T	C	8: 70,891,179	T160A	probably damaging	Het
Srcap	T	G	7: 127,553,296		probably null	Het
Tcrg-V5	A	C	13: 19,192,558	E42D	possibly damaging	Het
Tgm6	T	A	2: 130,141,908	M329K	possibly damaging	Het
Tom1l1	G	A	11: 90,661,774	A201V	probably benign	Het
Ttc13	T	C	8: 124,675,263	T662A	possibly damaging	Het
Ttn	T	C	2: 76,725,255	T30469A	probably damaging	Het
Ube3a	T	A	7: 59,286,912	S645R	probably benign	Het
Vgll2	A	G	10: 52,025,166	E64G	probably damaging	Het
Vmn1r25	A	T	6: 57,979,075	C76*	probably null	Het
Vmn2r101	A	G	17: 19,588,842	N78D	probably damaging	Het
Zcchc10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	11: 53,332,517		probably benign	Het
Zcchc7	C	A	4: 44,926,048	A28E	probably damaging	Het

Other mutations in Nme8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01984:Nme8	APN	13	19688980	missense	probably damaging	1.00
IGL02272:Nme8	APN	13	19658826	missense	probably damaging	0.99
IGL02344:Nme8	APN	13	19674404	missense	possibly damaging	0.94
IGL02395:Nme8	APN	13	19677908	missense	possibly damaging	0.64
IGL02621:Nme8	APN	13	19675648	missense	probably damaging	1.00
IGL02645:Nme8	APN	13	19660585	missense	probably damaging	1.00
IGL02807:Nme8	APN	13	19675831	unclassified	probably benign
IGL03059:Nme8	APN	13	19652244	missense	possibly damaging	0.92
IGL03288:Nme8	APN	13	19696606	missense	possibly damaging	0.94
IGL03323:Nme8	APN	13	19688950	missense	probably benign	0.06
R0139:Nme8	UTSW	13	19677848	missense	probably benign	0.19
R0616:Nme8	UTSW	13	19690859	missense	probably benign	0.00
R0632:Nme8	UTSW	13	19658036	missense	probably damaging	0.96
R1233:Nme8	UTSW	13	19660512	missense	possibly damaging	0.71
R1288:Nme8	UTSW	13	19674449	missense	possibly damaging	0.87
R1305:Nme8	UTSW	13	19696907	missense	possibly damaging	0.90
R1773:Nme8	UTSW	13	19697036	start codon destroyed	probably damaging	1.00
R1942:Nme8	UTSW	13	19675808	missense	probably damaging	1.00
R1970:Nme8	UTSW	13	19652322	missense	probably damaging	1.00
R2012:Nme8	UTSW	13	19696883	missense	probably damaging	1.00
R2093:Nme8	UTSW	13	19650872	missense	probably damaging	1.00
R2392:Nme8	UTSW	13	19688943	critical splice donor site	probably null
R2436:Nme8	UTSW	13	19677859	missense	probably damaging	1.00
R2901:Nme8	UTSW	13	19675664	missense	probably benign	0.02
R2902:Nme8	UTSW	13	19675664	missense	probably benign	0.02
R4665:Nme8	UTSW	13	19674435	missense	probably damaging	1.00
R4751:Nme8	UTSW	13	19675638	critical splice donor site	probably null
R4785:Nme8	UTSW	13	19657930	missense	probably damaging	0.96
R5101:Nme8	UTSW	13	19690847	critical splice donor site	probably null
R5217:Nme8	UTSW	13	19696691	missense	probably damaging	1.00
R5251:Nme8	UTSW	13	19660625	missense	probably benign	0.33
R5356:Nme8	UTSW	13	19652299	missense	probably damaging	1.00
R5624:Nme8	UTSW	13	19677868	missense	possibly damaging	0.94
R6679:Nme8	UTSW	13	19690970	splice site	probably null
R7040:Nme8	UTSW	13	19694328	missense	probably damaging	1.00
R7111:Nme8	UTSW	13	19675647	missense	probably benign	0.06
R7185:Nme8	UTSW	13	19677883	missense	probably damaging	1.00
R7670:Nme8	UTSW	13	19658829	missense	probably benign	0.01
R7685:Nme8	UTSW	13	19650975	missense	probably benign	0.00
R8108:Nme8	UTSW	13	19650960	missense	probably benign	0.00
R8331:Nme8	UTSW	13	19658866	missense	probably damaging	1.00
R8413:Nme8	UTSW	13	19674519	missense	probably benign	0.01
R8808:Nme8	UTSW	13	19675808	missense	probably damaging	1.00
R9227:Nme8	UTSW	13	19690214	missense	probably benign
R9230:Nme8	UTSW	13	19690214	missense	probably benign
R9422:Nme8	UTSW	13	19675748	missense	probably benign	0.01
Z1088:Nme8	UTSW	13	19688957	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GTGCAATAGTTTTAACAAGCTCCTG -3'
(R):5'- AATGCATGCTGTTTGACCTGC -3'

Sequencing Primer
(F):5'- TTTAACAAGCTCCTGGGAGG -3'
(R):5'- ATGCTGTTTGACCTGCATACAAC -3'

Posted On

2016-09-06