Incidental Mutation 'R5397:Nme8'
ID429766
Institutional Source Beutler Lab
Gene Symbol Nme8
Ensembl Gene ENSMUSG00000041138
Gene NameNME/NM23 family member 8
SynonymsSptrx-2, 1700056P15Rik, Txndc3
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location19645078-19697794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19694379 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000089358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763]
Predicted Effect probably damaging
Transcript: ENSMUST00000039340
AA Change: D70G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138
AA Change: D70G

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 3.7e-12 PFAM
Pfam:NDK 155 283 2.3e-14 PFAM
NDK 312 452 3.8e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091763
AA Change: D70G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138
AA Change: D70G

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 6.9e-12 PFAM
Pfam:NDK 155 284 1.1e-13 PFAM
NDK 312 449 2.75e-25 SMART
NDK 450 586 1.45e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223286
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Nme8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Nme8 APN 13 19688980 missense probably damaging 1.00
IGL02272:Nme8 APN 13 19658826 missense probably damaging 0.99
IGL02344:Nme8 APN 13 19674404 missense possibly damaging 0.94
IGL02395:Nme8 APN 13 19677908 missense possibly damaging 0.64
IGL02621:Nme8 APN 13 19675648 missense probably damaging 1.00
IGL02645:Nme8 APN 13 19660585 missense probably damaging 1.00
IGL02807:Nme8 APN 13 19675831 unclassified probably benign
IGL03059:Nme8 APN 13 19652244 missense possibly damaging 0.92
IGL03288:Nme8 APN 13 19696606 missense possibly damaging 0.94
IGL03323:Nme8 APN 13 19688950 missense probably benign 0.06
R0139:Nme8 UTSW 13 19677848 missense probably benign 0.19
R0616:Nme8 UTSW 13 19690859 missense probably benign 0.00
R0632:Nme8 UTSW 13 19658036 missense probably damaging 0.96
R1233:Nme8 UTSW 13 19660512 missense possibly damaging 0.71
R1288:Nme8 UTSW 13 19674449 missense possibly damaging 0.87
R1305:Nme8 UTSW 13 19696907 missense possibly damaging 0.90
R1773:Nme8 UTSW 13 19697036 start codon destroyed probably damaging 1.00
R1942:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R1970:Nme8 UTSW 13 19652322 missense probably damaging 1.00
R2012:Nme8 UTSW 13 19696883 missense probably damaging 1.00
R2093:Nme8 UTSW 13 19650872 missense probably damaging 1.00
R2392:Nme8 UTSW 13 19688943 critical splice donor site probably null
R2436:Nme8 UTSW 13 19677859 missense probably damaging 1.00
R2901:Nme8 UTSW 13 19675664 missense probably benign 0.02
R2902:Nme8 UTSW 13 19675664 missense probably benign 0.02
R4665:Nme8 UTSW 13 19674435 missense probably damaging 1.00
R4751:Nme8 UTSW 13 19675638 critical splice donor site probably null
R4785:Nme8 UTSW 13 19657930 missense probably damaging 0.96
R5101:Nme8 UTSW 13 19690847 critical splice donor site probably null
R5217:Nme8 UTSW 13 19696691 missense probably damaging 1.00
R5251:Nme8 UTSW 13 19660625 missense probably benign 0.33
R5356:Nme8 UTSW 13 19652299 missense probably damaging 1.00
R5624:Nme8 UTSW 13 19677868 missense possibly damaging 0.94
R6679:Nme8 UTSW 13 19690970 splice site probably null
R7040:Nme8 UTSW 13 19694328 missense probably damaging 1.00
R7111:Nme8 UTSW 13 19675647 missense probably benign 0.06
R7185:Nme8 UTSW 13 19677883 missense probably damaging 1.00
R7670:Nme8 UTSW 13 19658829 missense probably benign 0.01
R7685:Nme8 UTSW 13 19650975 missense probably benign 0.00
R8108:Nme8 UTSW 13 19650960 missense probably benign 0.00
R8331:Nme8 UTSW 13 19658866 missense probably damaging 1.00
Z1088:Nme8 UTSW 13 19688957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTGCAATAGTTTTAACAAGCTCCTG -3'
(R):5'- AATGCATGCTGTTTGACCTGC -3'

Sequencing Primer
(F):5'- TTTAACAAGCTCCTGGGAGG -3'
(R):5'- ATGCTGTTTGACCTGCATACAAC -3'
Posted On2016-09-06