Incidental Mutation 'R3109:Alkbh3'
ID263691
Institutional Source Beutler Lab
Gene Symbol Alkbh3
Ensembl Gene ENSMUSG00000040174
Gene NamealkB homolog 3, alpha-ketoglutarate-dependent dioxygenase
SynonymsmABH3, 1700108H04Rik, 1810020C19Rik, Abh3
MMRRC Submission 040583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R3109 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location93980550-94010807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94004763 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 80 (E80G)
Ref Sequence ENSEMBL: ENSMUSP00000122043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040005] [ENSMUST00000111240] [ENSMUST00000126378]
Predicted Effect probably damaging
Transcript: ENSMUST00000040005
AA Change: E79G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038721
Gene: ENSMUSG00000040174
AA Change: E79G

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 89 275 2e-34 PFAM
Pfam:2OG-FeII_Oxy 172 277 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111240
AA Change: E80G

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106871
Gene: ENSMUSG00000040174
AA Change: E80G

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 276 3.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126378
AA Change: E80G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122043
Gene: ENSMUSG00000040174
AA Change: E80G

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 202 8.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156763
Meta Mutation Damage Score 0.3114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 (MIM 610602) and ALKBH3 are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal lifespan and are phenotypically indistinguishable from control littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,442,456 E323G probably damaging Het
Adamts20 T C 15: 94,345,904 probably benign Het
Amfr T C 8: 94,000,306 Y93C probably damaging Het
Arid2 T C 15: 96,356,746 Y158H probably damaging Het
Camk1g T C 1: 193,354,993 Y133C probably damaging Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd1b G A 1: 139,041,916 probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Igfn1 T C 1: 135,997,848 D56G probably benign Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Klhdc4 A C 8: 121,821,334 H72Q probably damaging Het
Kmt2c A G 5: 25,275,735 Y1459H probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Per2 A T 1: 91,445,575 C164S probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbl2 T A 8: 91,102,235 I588N probably benign Het
Rslcan18 C T 13: 67,098,607 E314K possibly damaging Het
Ubr3 A T 2: 69,988,840 T1325S probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Other mutations in Alkbh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Alkbh3 APN 2 94003051 critical splice donor site probably null
IGL01940:Alkbh3 APN 2 93981595 missense probably damaging 0.98
IGL02554:Alkbh3 APN 2 93996347 missense probably damaging 1.00
IGL02638:Alkbh3 APN 2 94008113 missense probably benign 0.02
IGL02640:Alkbh3 APN 2 93996361 missense possibly damaging 0.90
R0409:Alkbh3 UTSW 2 94001448 missense possibly damaging 0.84
R0437:Alkbh3 UTSW 2 93981569 missense probably damaging 1.00
R1456:Alkbh3 UTSW 2 94001419 splice site probably null
R1592:Alkbh3 UTSW 2 94008424 intron probably null
R2359:Alkbh3 UTSW 2 94008113 missense probably benign 0.01
R4297:Alkbh3 UTSW 2 94008124 missense probably benign
R5562:Alkbh3 UTSW 2 93996379 unclassified probably null
R6216:Alkbh3 UTSW 2 94008536 start gained probably benign
R7088:Alkbh3 UTSW 2 94004752 missense possibly damaging 0.55
R7711:Alkbh3 UTSW 2 94008092 missense probably benign
R8014:Alkbh3 UTSW 2 94001513 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCGTGTAACTGGTGGAAG -3'
(R):5'- GTTTCATGGCCTGAACCTGTC -3'

Sequencing Primer
(F):5'- GGAAGCTGTGAAAATATTTTGATGC -3'
(R):5'- TGTTCCCAGCGCCATTGAG -3'
Posted On2015-02-05