Incidental Mutation 'R3151:Rpf1'
ID264390
Institutional Source Beutler Lab
Gene Symbol Rpf1
Ensembl Gene ENSMUSG00000028187
Gene Nameribosome production factor 1 homolog
SynonymsBxdc5, 2210420E24Rik, 2310066N05Rik
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146505956-146521429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146507635 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 254 (R254W)
Ref Sequence ENSEMBL: ENSMUSP00000029838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029838] [ENSMUST00000090031] [ENSMUST00000118280] [ENSMUST00000119130] [ENSMUST00000199079]
Predicted Effect probably damaging
Transcript: ENSMUST00000029838
AA Change: R254W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029838
Gene: ENSMUSG00000028187
AA Change: R254W

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 92 N/A INTRINSIC
Brix 145 319 4.82e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090031
SMART Domains Protein: ENSMUSP00000087485
Gene: ENSMUSG00000068523

DomainStartEndE-ValueType
G_gamma 4 68 1.06e-20 SMART
GGL 7 68 2.79e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118280
SMART Domains Protein: ENSMUSP00000114014
Gene: ENSMUSG00000068523

DomainStartEndE-ValueType
G_gamma 4 68 1.06e-20 SMART
GGL 7 68 2.79e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119130
SMART Domains Protein: ENSMUSP00000113018
Gene: ENSMUSG00000068523

DomainStartEndE-ValueType
G_gamma 1 67 9.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196909
Predicted Effect probably benign
Transcript: ENSMUST00000199079
SMART Domains Protein: ENSMUSP00000143279
Gene: ENSMUSG00000028187

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 92 N/A INTRINSIC
Pfam:Brix 146 211 4.7e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000199174
AA Change: R48W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200583
Meta Mutation Damage Score 0.4586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Rpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Rpf1 APN 3 146512247 missense probably benign 0.10
IGL01371:Rpf1 APN 3 146507547 missense probably damaging 1.00
IGL01729:Rpf1 APN 3 146507149 missense probably damaging 1.00
IGL02122:Rpf1 APN 3 146521267 missense probably benign
R0196:Rpf1 UTSW 3 146508149 missense possibly damaging 0.86
R1664:Rpf1 UTSW 3 146512148 missense probably benign 0.01
R2019:Rpf1 UTSW 3 146521221 missense probably damaging 1.00
R4989:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5133:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5134:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5172:Rpf1 UTSW 3 146512295 missense possibly damaging 0.94
R5383:Rpf1 UTSW 3 146519391 missense possibly damaging 0.92
R5525:Rpf1 UTSW 3 146517804 splice site silent
R5927:Rpf1 UTSW 3 146519463 splice site probably null
R5947:Rpf1 UTSW 3 146506544 missense probably damaging 1.00
R7070:Rpf1 UTSW 3 146512184 missense probably damaging 1.00
R7311:Rpf1 UTSW 3 146507163 missense probably benign 0.42
R8345:Rpf1 UTSW 3 146507676 missense probably benign 0.17
Y5404:Rpf1 UTSW 3 146512836 missense probably damaging 1.00
Y5405:Rpf1 UTSW 3 146512836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGTGGCAATGCTTAAAG -3'
(R):5'- TTGACAACAGTAGTCCTCATTACCC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- AAGTTCTAAGCCGTTCTGAGCCAG -3'
Posted On2015-02-05