Incidental Mutation 'R5525:Rpf1'
ID501102
Institutional Source Beutler Lab
Gene Symbol Rpf1
Ensembl Gene ENSMUSG00000028187
Gene Nameribosome production factor 1 homolog
SynonymsBxdc5, 2210420E24Rik, 2310066N05Rik
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146505956-146521429 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 146517804 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029838] [ENSMUST00000199079]
Predicted Effect silent
Transcript: ENSMUST00000029838
SMART Domains Protein: ENSMUSP00000029838
Gene: ENSMUSG00000028187

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 92 N/A INTRINSIC
Brix 145 319 4.82e-54 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196909
Predicted Effect silent
Transcript: ENSMUST00000199079
SMART Domains Protein: ENSMUSP00000143279
Gene: ENSMUSG00000028187

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 92 N/A INTRINSIC
Pfam:Brix 146 211 4.7e-11 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Rpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Rpf1 APN 3 146512247 missense probably benign 0.10
IGL01371:Rpf1 APN 3 146507547 missense probably damaging 1.00
IGL01729:Rpf1 APN 3 146507149 missense probably damaging 1.00
IGL02122:Rpf1 APN 3 146521267 missense probably benign
R0196:Rpf1 UTSW 3 146508149 missense possibly damaging 0.86
R1664:Rpf1 UTSW 3 146512148 missense probably benign 0.01
R2019:Rpf1 UTSW 3 146521221 missense probably damaging 1.00
R3151:Rpf1 UTSW 3 146507635 missense probably damaging 1.00
R4989:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5133:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5134:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5172:Rpf1 UTSW 3 146512295 missense possibly damaging 0.94
R5383:Rpf1 UTSW 3 146519391 missense possibly damaging 0.92
R5927:Rpf1 UTSW 3 146519463 intron probably null
R5947:Rpf1 UTSW 3 146506544 missense probably damaging 1.00
R7070:Rpf1 UTSW 3 146512184 missense probably damaging 1.00
R7311:Rpf1 UTSW 3 146507163 missense probably benign 0.42
Y5404:Rpf1 UTSW 3 146512836 missense probably damaging 1.00
Y5405:Rpf1 UTSW 3 146512836 missense probably damaging 1.00
Predicted Primers
Posted On2017-12-01