Incidental Mutation 'R3037:Topors'
ID264838
Institutional Source Beutler Lab
Gene Symbol Topors
Ensembl Gene ENSMUSG00000036822
Gene Nametopoisomerase I binding, arginine/serine-rich
Synonyms
MMRRC Submission 040553-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R3037 (G1)
Quality Score143
Status Not validated
Chromosome4
Chromosomal Location40259601-40269850 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 40269673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042575] [ENSMUST00000042575] [ENSMUST00000042575] [ENSMUST00000095128] [ENSMUST00000108108] [ENSMUST00000129758]
Predicted Effect probably null
Transcript: ENSMUST00000042575
SMART Domains Protein: ENSMUSP00000046843
Gene: ENSMUSG00000036822

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 29 44 N/A INTRINSIC
RING 104 142 7.27e-7 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 465 478 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 589 610 N/A INTRINSIC
low complexity region 620 696 N/A INTRINSIC
low complexity region 756 780 N/A INTRINSIC
low complexity region 837 860 N/A INTRINSIC
low complexity region 877 894 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042575
SMART Domains Protein: ENSMUSP00000046843
Gene: ENSMUSG00000036822

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 29 44 N/A INTRINSIC
RING 104 142 7.27e-7 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 465 478 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 589 610 N/A INTRINSIC
low complexity region 620 696 N/A INTRINSIC
low complexity region 756 780 N/A INTRINSIC
low complexity region 837 860 N/A INTRINSIC
low complexity region 877 894 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042575
SMART Domains Protein: ENSMUSP00000046843
Gene: ENSMUSG00000036822

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 29 44 N/A INTRINSIC
RING 104 142 7.27e-7 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 465 478 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 589 610 N/A INTRINSIC
low complexity region 620 696 N/A INTRINSIC
low complexity region 756 780 N/A INTRINSIC
low complexity region 837 860 N/A INTRINSIC
low complexity region 877 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095128
SMART Domains Protein: ENSMUSP00000092746
Gene: ENSMUSG00000071014

DomainStartEndE-ValueType
Pfam:NDUF_B6 1 128 2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108108
SMART Domains Protein: ENSMUSP00000103743
Gene: ENSMUSG00000071014

DomainStartEndE-ValueType
Pfam:NDUF_B6 1 62 1.5e-22 PFAM
Pfam:NDUF_B6 55 97 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207780
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which is serine and arginine rich, and contains a RING-type zinc finger domain. It is highly expressed in the testis, and functions as an ubiquitin-protein E3 ligase. Mutations in this gene are associated with retinitis pigmentosa type 31. Alternatively spliced transcript variants, encoding different isoforms, have been observed for this locus. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,445,978 probably null Het
Bco1 A G 8: 117,127,539 Y401C probably benign Het
Bod1l A T 5: 41,822,037 S645T probably damaging Het
Cat A G 2: 103,467,777 Y274H probably benign Het
Cdh19 C A 1: 110,954,607 V52F probably damaging Het
Cntnap2 G A 6: 46,015,266 V376I possibly damaging Het
Dll3 A G 7: 28,299,117 L141P probably damaging Het
Ets2 C A 16: 95,716,065 N280K probably benign Het
Fam186a G T 15: 99,943,794 P1523Q probably damaging Het
Fcgbp A G 7: 28,102,702 I1352V possibly damaging Het
Fuk A T 8: 110,894,718 probably null Het
Gng11 A G 6: 4,008,051 E38G probably benign Het
Gsdmc2 A T 15: 63,833,331 F178I probably benign Het
Il11ra1 T A 4: 41,765,074 S133R possibly damaging Het
Kcnab2 T A 4: 152,393,756 I349F possibly damaging Het
Kctd10 A G 5: 114,375,000 V38A probably damaging Het
Lrig3 A G 10: 126,010,032 R777G probably damaging Het
Naip2 A C 13: 100,154,949 D1160E probably benign Het
Nanog C A 6: 122,713,268 Q186K possibly damaging Het
Nlrc3 T C 16: 3,952,408 N249S probably damaging Het
Nup214 A T 2: 31,976,620 T56S probably benign Het
Olfr228 A T 2: 86,483,643 I33N probably damaging Het
Pcdhb1 T G 18: 37,265,113 M39R probably damaging Het
Pced1a A C 2: 130,419,859 D291E probably benign Het
Pdia6 C T 12: 17,279,645 R261W probably damaging Het
Pdlim4 C A 11: 54,056,257 G72V probably benign Het
Plce1 G A 19: 38,777,884 D2104N probably damaging Het
Ptprk T C 10: 28,580,478 L7P probably damaging Het
Rad21l A T 2: 151,660,780 F170Y probably damaging Het
Scaf1 T C 7: 45,007,347 probably benign Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Tspan5 G A 3: 138,898,355 G167D probably damaging Het
Ttyh3 C A 5: 140,648,842 probably benign Het
Usp15 C A 10: 123,163,617 W220L probably damaging Het
Vmn2r77 A T 7: 86,800,983 I146L probably benign Het
Ythdf3 T C 3: 16,205,191 F501L probably benign Het
Zc3h4 A G 7: 16,421,485 D241G unknown Het
Other mutations in Topors
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Topors APN 4 40262417 missense probably damaging 1.00
IGL01541:Topors APN 4 40262364 missense possibly damaging 0.70
IGL02093:Topors APN 4 40261467 missense probably damaging 0.98
R0039:Topors UTSW 4 40262772 missense probably damaging 1.00
R0483:Topors UTSW 4 40261952 missense probably damaging 0.96
R0645:Topors UTSW 4 40260333 missense unknown
R1413:Topors UTSW 4 40261982 missense probably benign 0.01
R1507:Topors UTSW 4 40261829 missense probably damaging 0.99
R1677:Topors UTSW 4 40261776 missense probably damaging 0.99
R1863:Topors UTSW 4 40262149 nonsense probably null
R1960:Topors UTSW 4 40261044 missense unknown
R2035:Topors UTSW 4 40262879 missense probably damaging 1.00
R2155:Topors UTSW 4 40262790 missense possibly damaging 0.72
R2519:Topors UTSW 4 40261714 nonsense probably null
R3035:Topors UTSW 4 40269673 critical splice donor site probably null
R3842:Topors UTSW 4 40262123 missense probably benign 0.01
R4090:Topors UTSW 4 40260794 missense unknown
R4668:Topors UTSW 4 40262669 missense probably damaging 0.98
R4686:Topors UTSW 4 40261694 missense probably benign 0.03
R4694:Topors UTSW 4 40261442 missense possibly damaging 0.94
R4749:Topors UTSW 4 40261015 missense unknown
R5228:Topors UTSW 4 40262367 missense probably damaging 1.00
R5304:Topors UTSW 4 40262541 missense possibly damaging 0.50
R5725:Topors UTSW 4 40261952 missense probably damaging 0.96
R6617:Topors UTSW 4 40261896 nonsense probably null
R6699:Topors UTSW 4 40262300 missense probably damaging 0.97
R6869:Topors UTSW 4 40261201 missense unknown
R7103:Topors UTSW 4 40261706 missense probably benign 0.03
R7319:Topors UTSW 4 40260540 missense unknown
R7543:Topors UTSW 4 40268312 missense probably damaging 0.99
R7545:Topors UTSW 4 40262173 missense possibly damaging 0.91
R7559:Topors UTSW 4 40261401 missense unknown
R7748:Topors UTSW 4 40262654 missense probably damaging 1.00
R7899:Topors UTSW 4 40260356 missense unknown
R8045:Topors UTSW 4 40261988 missense probably benign 0.17
R8056:Topors UTSW 4 40262221 missense probably benign 0.30
R8221:Topors UTSW 4 40260686 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTCCCTCTGCTGCCTGAAAG -3'
(R):5'- TAACACAGTGCAGCCCAGAG -3'

Sequencing Primer
(F):5'- CCTGAAAGGCGGGCTAGG -3'
(R):5'- AAAAGCGTGTCCTCCAGG -3'
Posted On2015-02-05