Incidental Mutation 'R3037:Ets2'
ID264867
Institutional Source Beutler Lab
Gene Symbol Ets2
Ensembl Gene ENSMUSG00000022895
Gene NameE26 avian leukemia oncogene 2, 3' domain
SynonymsEts-2
MMRRC Submission 040553-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3037 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location95702407-95721045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95716065 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 280 (N280K)
Ref Sequence ENSEMBL: ENSMUSP00000116638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023612] [ENSMUST00000155226]
Predicted Effect probably benign
Transcript: ENSMUST00000023612
AA Change: N280K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023612
Gene: ENSMUSG00000022895
AA Change: N280K

DomainStartEndE-ValueType
SAM_PNT 87 170 3.35e-43 SMART
low complexity region 259 269 N/A INTRINSIC
ETS 361 446 8.49e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143554
Predicted Effect probably benign
Transcript: ENSMUST00000155226
AA Change: N280K

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116638
Gene: ENSMUSG00000022895
AA Change: N280K

DomainStartEndE-ValueType
SAM_PNT 87 170 3.35e-43 SMART
low complexity region 259 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defective trophoblast formation and die by embryonic day 8.5, but tetraploid chimeric rescue results in viable and fertile mutants with wavy hair. Mammary tumors induced in carriers are reduced in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,445,978 probably null Het
Bco1 A G 8: 117,127,539 Y401C probably benign Het
Bod1l A T 5: 41,822,037 S645T probably damaging Het
Cat A G 2: 103,467,777 Y274H probably benign Het
Cdh19 C A 1: 110,954,607 V52F probably damaging Het
Cntnap2 G A 6: 46,015,266 V376I possibly damaging Het
Dll3 A G 7: 28,299,117 L141P probably damaging Het
Fam186a G T 15: 99,943,794 P1523Q probably damaging Het
Fcgbp A G 7: 28,102,702 I1352V possibly damaging Het
Fuk A T 8: 110,894,718 probably null Het
Gng11 A G 6: 4,008,051 E38G probably benign Het
Gsdmc2 A T 15: 63,833,331 F178I probably benign Het
Il11ra1 T A 4: 41,765,074 S133R possibly damaging Het
Kcnab2 T A 4: 152,393,756 I349F possibly damaging Het
Kctd10 A G 5: 114,375,000 V38A probably damaging Het
Lrig3 A G 10: 126,010,032 R777G probably damaging Het
Naip2 A C 13: 100,154,949 D1160E probably benign Het
Nanog C A 6: 122,713,268 Q186K possibly damaging Het
Nlrc3 T C 16: 3,952,408 N249S probably damaging Het
Nup214 A T 2: 31,976,620 T56S probably benign Het
Olfr228 A T 2: 86,483,643 I33N probably damaging Het
Pcdhb1 T G 18: 37,265,113 M39R probably damaging Het
Pced1a A C 2: 130,419,859 D291E probably benign Het
Pdia6 C T 12: 17,279,645 R261W probably damaging Het
Pdlim4 C A 11: 54,056,257 G72V probably benign Het
Plce1 G A 19: 38,777,884 D2104N probably damaging Het
Ptprk T C 10: 28,580,478 L7P probably damaging Het
Rad21l A T 2: 151,660,780 F170Y probably damaging Het
Scaf1 T C 7: 45,007,347 probably benign Het
Topors C T 4: 40,269,673 probably null Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Tspan5 G A 3: 138,898,355 G167D probably damaging Het
Ttyh3 C A 5: 140,648,842 probably benign Het
Usp15 C A 10: 123,163,617 W220L probably damaging Het
Vmn2r77 A T 7: 86,800,983 I146L probably benign Het
Ythdf3 T C 3: 16,205,191 F501L probably benign Het
Zc3h4 A G 7: 16,421,485 D241G unknown Het
Other mutations in Ets2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Ets2 APN 16 95712141 missense probably benign 0.01
IGL00843:Ets2 APN 16 95709793 missense probably benign 0.03
IGL01911:Ets2 APN 16 95711758 missense probably damaging 1.00
R0257:Ets2 UTSW 16 95712201 nonsense probably null
R0317:Ets2 UTSW 16 95712149 missense probably damaging 1.00
R0398:Ets2 UTSW 16 95716223 missense probably damaging 1.00
R0478:Ets2 UTSW 16 95716262 missense probably damaging 1.00
R0634:Ets2 UTSW 16 95716156 missense possibly damaging 0.87
R1621:Ets2 UTSW 16 95709869 missense probably damaging 1.00
R1868:Ets2 UTSW 16 95715074 missense probably benign 0.00
R2120:Ets2 UTSW 16 95718933 missense probably benign 0.17
R3915:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R4086:Ets2 UTSW 16 95709789 missense probably damaging 1.00
R4609:Ets2 UTSW 16 95711774 missense probably benign 0.03
R4760:Ets2 UTSW 16 95719043 missense probably damaging 1.00
R5245:Ets2 UTSW 16 95712260 nonsense probably null
R5551:Ets2 UTSW 16 95712121 missense probably damaging 1.00
R6057:Ets2 UTSW 16 95714372 missense probably benign 0.00
R6376:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R7545:Ets2 UTSW 16 95715083 missense probably benign 0.45
R7905:Ets2 UTSW 16 95706437 missense probably damaging 0.97
R7988:Ets2 UTSW 16 95706437 missense probably damaging 0.97
R8013:Ets2 UTSW 16 95716100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTGACACTGTACCAGC -3'
(R):5'- CTGCAGGAATAACTGGTTTGC -3'

Sequencing Primer
(F):5'- ACACTGTACCAGCCGTGTGTATAG -3'
(R):5'- CAGGAATAACTGGTTTGCCTTGCTC -3'
Posted On2015-02-05