Incidental Mutation 'R4086:Ets2'
ID317390
Institutional Source Beutler Lab
Gene Symbol Ets2
Ensembl Gene ENSMUSG00000022895
Gene NameE26 avian leukemia oncogene 2, 3' domain
SynonymsEts-2
MMRRC Submission 041625-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4086 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location95702407-95721045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95709789 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 30 (D30E)
Ref Sequence ENSEMBL: ENSMUSP00000023612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023612] [ENSMUST00000155226]
Predicted Effect probably damaging
Transcript: ENSMUST00000023612
AA Change: D30E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023612
Gene: ENSMUSG00000022895
AA Change: D30E

DomainStartEndE-ValueType
SAM_PNT 87 170 3.35e-43 SMART
low complexity region 259 269 N/A INTRINSIC
ETS 361 446 8.49e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145509
Predicted Effect probably damaging
Transcript: ENSMUST00000155226
AA Change: D30E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116638
Gene: ENSMUSG00000022895
AA Change: D30E

DomainStartEndE-ValueType
SAM_PNT 87 170 3.35e-43 SMART
low complexity region 259 269 N/A INTRINSIC
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defective trophoblast formation and die by embryonic day 8.5, but tetraploid chimeric rescue results in viable and fertile mutants with wavy hair. Mammary tumors induced in carriers are reduced in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd7 G A 2: 3,340,451 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Adcy7 A G 8: 88,315,786 D427G probably benign Het
Adrm1 A G 2: 180,172,834 probably benign Het
Arfgef1 T C 1: 10,163,759 I1103M probably benign Het
Arhgap32 A C 9: 32,247,066 probably benign Het
Arhgef28 T C 13: 97,967,204 R767G probably damaging Het
BC046251 A G 7: 65,582,148 noncoding transcript Het
Brwd1 T C 16: 96,046,372 S683G probably benign Het
Calcoco1 C G 15: 102,710,399 probably benign Het
Carmil1 G T 13: 24,024,461 P834T possibly damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col24a1 G A 3: 145,461,437 G1090R probably damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Fam181b T C 7: 93,080,580 V187A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo41 C T 6: 85,478,546 R552Q possibly damaging Het
Fstl5 G T 3: 76,648,286 C53F probably damaging Het
Ftsj3 T C 11: 106,249,569 Y791C probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 A G 5: 109,943,255 K458E probably benign Het
Hecw2 T C 1: 53,831,656 I1389V probably damaging Het
Ipo9 A G 1: 135,388,690 probably benign Het
Krtap31-1 C T 11: 99,908,319 T116I possibly damaging Het
Mafa T G 15: 75,747,137 K262N probably damaging Het
Nxph4 T C 10: 127,526,686 Y112C probably damaging Het
Olfr814 A G 10: 129,874,298 V153A possibly damaging Het
Olfr987 C A 2: 85,331,826 W24L probably benign Het
Pgls G A 8: 71,596,090 A142T probably damaging Het
Phlpp1 A G 1: 106,347,161 I885V probably benign Het
Prkcq A G 2: 11,283,868 D544G probably damaging Het
Rnf44 T C 13: 54,682,335 N254D possibly damaging Het
Sept10 A T 10: 59,192,223 L92* probably null Het
Slc14a2 A T 18: 78,205,783 I156N probably damaging Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Thap12 A G 7: 98,716,494 D623G possibly damaging Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ube2u T A 4: 100,549,842 I187N probably benign Het
Vmn1r90 G A 7: 14,563,294 probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xpo4 C T 14: 57,643,033 probably benign Het
Zbtb21 A T 16: 97,952,763 Y135N probably damaging Het
Zbtb22 T A 17: 33,918,168 V429D probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zhx1 T C 15: 58,052,921 E643G possibly damaging Het
Zzef1 C T 11: 72,875,053 H1469Y probably benign Het
Other mutations in Ets2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Ets2 APN 16 95712141 missense probably benign 0.01
IGL00843:Ets2 APN 16 95709793 missense probably benign 0.03
IGL01911:Ets2 APN 16 95711758 missense probably damaging 1.00
R0257:Ets2 UTSW 16 95712201 nonsense probably null
R0317:Ets2 UTSW 16 95712149 missense probably damaging 1.00
R0398:Ets2 UTSW 16 95716223 missense probably damaging 1.00
R0478:Ets2 UTSW 16 95716262 missense probably damaging 1.00
R0634:Ets2 UTSW 16 95716156 missense possibly damaging 0.87
R1621:Ets2 UTSW 16 95709869 missense probably damaging 1.00
R1868:Ets2 UTSW 16 95715074 missense probably benign 0.00
R2120:Ets2 UTSW 16 95718933 missense probably benign 0.17
R3037:Ets2 UTSW 16 95716065 missense probably benign 0.19
R3915:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R4609:Ets2 UTSW 16 95711774 missense probably benign 0.03
R4760:Ets2 UTSW 16 95719043 missense probably damaging 1.00
R5245:Ets2 UTSW 16 95712260 nonsense probably null
R5551:Ets2 UTSW 16 95712121 missense probably damaging 1.00
R6057:Ets2 UTSW 16 95714372 missense probably benign 0.00
R6376:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R7545:Ets2 UTSW 16 95715083 missense probably benign 0.45
R7905:Ets2 UTSW 16 95706437 missense probably damaging 0.97
R7988:Ets2 UTSW 16 95706437 missense probably damaging 0.97
R8013:Ets2 UTSW 16 95716100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATAATCTTCCAGGCCATCAG -3'
(R):5'- TCTTGGCTAGAGAATGGTCTATCTC -3'

Sequencing Primer
(F):5'- CAGGCCCTATGAGGTTAATTAAAG -3'
(R):5'- AAGCCATGCATCTGTCAG -3'
Posted On2015-05-15