Incidental Mutation 'R7905:Ets2'
ID 610240
Institutional Source Beutler Lab
Gene Symbol Ets2
Ensembl Gene ENSMUSG00000022895
Gene Name E26 avian leukemia oncogene 2, 3' domain
Synonyms Ets-2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7905 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 95702407-95721045 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 95706437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 6 (I6N)
Ref Sequence ENSEMBL: ENSMUSP00000023612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023612]
AlphaFold P15037
Predicted Effect probably damaging
Transcript: ENSMUST00000023612
AA Change: I6N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023612
Gene: ENSMUSG00000022895
AA Change: I6N

DomainStartEndE-ValueType
SAM_PNT 87 170 3.35e-43 SMART
low complexity region 259 269 N/A INTRINSIC
ETS 361 446 8.49e-57 SMART
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defective trophoblast formation and die by embryonic day 8.5, but tetraploid chimeric rescue results in viable and fertile mutants with wavy hair. Mammary tumors induced in carriers are reduced in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Ldhc A G 7: 46,875,531 probably null Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Ets2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Ets2 APN 16 95712141 missense probably benign 0.01
IGL00843:Ets2 APN 16 95709793 missense probably benign 0.03
IGL01911:Ets2 APN 16 95711758 missense probably damaging 1.00
R0257:Ets2 UTSW 16 95712201 nonsense probably null
R0317:Ets2 UTSW 16 95712149 missense probably damaging 1.00
R0398:Ets2 UTSW 16 95716223 missense probably damaging 1.00
R0478:Ets2 UTSW 16 95716262 missense probably damaging 1.00
R0634:Ets2 UTSW 16 95716156 missense possibly damaging 0.87
R1621:Ets2 UTSW 16 95709869 missense probably damaging 1.00
R1868:Ets2 UTSW 16 95715074 missense probably benign 0.00
R2120:Ets2 UTSW 16 95718933 missense probably benign 0.17
R3037:Ets2 UTSW 16 95716065 missense probably benign 0.19
R3915:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R4086:Ets2 UTSW 16 95709789 missense probably damaging 1.00
R4609:Ets2 UTSW 16 95711774 missense probably benign 0.03
R4760:Ets2 UTSW 16 95719043 missense probably damaging 1.00
R5245:Ets2 UTSW 16 95712260 nonsense probably null
R5551:Ets2 UTSW 16 95712121 missense probably damaging 1.00
R6057:Ets2 UTSW 16 95714372 missense probably benign 0.00
R6376:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R7545:Ets2 UTSW 16 95715083 missense probably benign 0.45
R8013:Ets2 UTSW 16 95716100 missense probably damaging 1.00
R8297:Ets2 UTSW 16 95706454 missense probably damaging 1.00
R8482:Ets2 UTSW 16 95714975 missense probably benign 0.00
R9489:Ets2 UTSW 16 95715077 nonsense probably null
R9605:Ets2 UTSW 16 95715077 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTGTTCTGTCTGGCTAAAG -3'
(R):5'- AGGAACTTCAGGATGAACTCATC -3'

Sequencing Primer
(F):5'- CTGTCTGGCTAAAGATTGAAGCC -3'
(R):5'- ACTACTTCTATATTTTGGGGGACAG -3'
Posted On 2019-12-20