Incidental Mutation 'R3024:Chil6'
List |< first << previous [record 4 of 23] next >> last >|
ID265771
Institutional Source Beutler Lab
Gene Symbol Chil6
Ensembl Gene ENSMUSG00000027902
Gene Namechitinase-like 6
SynonymsBYm, BC051070
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location106387384-106406182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106388770 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 383 (D383G)
Ref Sequence ENSEMBL: ENSMUSP00000029510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029510]
Predicted Effect probably damaging
Transcript: ENSMUST00000029510
AA Change: D383G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029510
Gene: ENSMUSG00000027902
AA Change: D383G

DomainStartEndE-ValueType
Glyco_18 39 382 3.04e-122 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Chil6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Chil6 APN 3 106388825 missense probably damaging 1.00
IGL01735:Chil6 APN 3 106388688 critical splice donor site probably null
IGL01795:Chil6 APN 3 106388792 missense probably damaging 0.96
IGL02505:Chil6 APN 3 106405962 missense probably benign
IGL03164:Chil6 APN 3 106394398 missense probably benign 0.04
cold_cut UTSW 3 106389974 missense probably damaging 1.00
R0409:Chil6 UTSW 3 106404176 missense probably benign 0.44
R1761:Chil6 UTSW 3 106394338 missense probably damaging 1.00
R1967:Chil6 UTSW 3 106391154 missense possibly damaging 0.84
R2571:Chil6 UTSW 3 106390393 nonsense probably null
R3829:Chil6 UTSW 3 106405958 missense probably benign 0.00
R4835:Chil6 UTSW 3 106405974 nonsense probably null
R4851:Chil6 UTSW 3 106389928 missense possibly damaging 0.61
R4948:Chil6 UTSW 3 106388672 intron probably benign
R5056:Chil6 UTSW 3 106394343 missense probably damaging 1.00
R5244:Chil6 UTSW 3 106389974 missense probably damaging 1.00
R5555:Chil6 UTSW 3 106389952 missense possibly damaging 0.87
R5594:Chil6 UTSW 3 106394429 splice site probably null
R5633:Chil6 UTSW 3 106388752 missense probably damaging 1.00
R6194:Chil6 UTSW 3 106404876 critical splice donor site probably null
R6587:Chil6 UTSW 3 106404881 missense probably benign
R6613:Chil6 UTSW 3 106389875 missense probably benign 0.25
R6641:Chil6 UTSW 3 106388924 missense possibly damaging 0.61
R6651:Chil6 UTSW 3 106404260 missense probably damaging 1.00
R7094:Chil6 UTSW 3 106404170 missense probably damaging 0.96
R7161:Chil6 UTSW 3 106394412 missense probably benign 0.01
R7653:Chil6 UTSW 3 106394325 missense possibly damaging 0.82
X0026:Chil6 UTSW 3 106388968 missense probably benign 0.02
X0064:Chil6 UTSW 3 106404319 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAATCTCACTGGAAAAGTATCTGTC -3'
(R):5'- ATGGAGCCATTCAGGTCTGG -3'

Sequencing Primer
(F):5'- CTGTCATTTTAAGGCTTCCTTTGAG -3'
(R):5'- AGCCATTCAGGTCTGGAATGC -3'
Posted On2015-02-05