Incidental Mutation 'R3546:Ppp1r27'
ID268210
Institutional Source Beutler Lab
Gene Symbol Ppp1r27
Ensembl Gene ENSMUSG00000025129
Gene Nameprotein phosphatase 1, regulatory subunit 27
Synonyms1110033I14Rik, Dysfip1, toonin
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120549979-120551132 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120550685 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 90 (I90F)
Ref Sequence ENSEMBL: ENSMUSP00000026121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026121] [ENSMUST00000034913]
Predicted Effect probably damaging
Transcript: ENSMUST00000026121
AA Change: I90F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026121
Gene: ENSMUSG00000025129
AA Change: I90F

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
ANK 63 92 1.64e-5 SMART
ANK 96 125 3.1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034913
SMART Domains Protein: ENSMUSP00000034913
Gene: ENSMUSG00000061111

DomainStartEndE-ValueType
Pfam:FAM195 4 94 3.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135515
Meta Mutation Damage Score 0.6303 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Ppp1r27
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3547:Ppp1r27 UTSW 11 120550685 missense probably damaging 0.99
R3917:Ppp1r27 UTSW 11 120550959 missense possibly damaging 0.89
R4640:Ppp1r27 UTSW 11 120550727 missense possibly damaging 0.79
R5305:Ppp1r27 UTSW 11 120550917 missense probably benign 0.41
R7574:Ppp1r27 UTSW 11 120551030 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCTGTGGCCAGATTTTCCG -3'
(R):5'- TAACTGAGAGTCTGGCCTTCTG -3'

Sequencing Primer
(F):5'- TAGAAACTGCCAGAATCCCTGAGTTG -3'
(R):5'- CTTCTGTCCATAAGGAGGCAG -3'
Posted On2015-02-19