Mutagenetix > Incidental Mutation

Incidental Mutation 'R3546:Fap'

268191

Institutional Source

Beutler Lab

Gene Symbol

Fap

Ensembl Gene

ENSMUSG00000000392

Gene Name

fibroblast activation protein

Synonyms

MMRRC Submission

040665-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3546 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62500943-62574075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 62519011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 478 (L478R)

Ref Sequence

ENSEMBL: ENSMUSP00000000402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000174234] [ENSMUST00000174448]

AlphaFold

P97321

Predicted Effect

probably damaging
Transcript: ENSMUST00000000402
AA Change: L478R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: L478R

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:DPPIV_N	73	440	2e-110	PFAM
Pfam:Abhydrolase_5	504	719	2.4e-12	PFAM
Pfam:Abhydrolase_6	515	703	2.3e-10	PFAM
Pfam:Peptidase_S9	520	727	9.4e-60	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102732
AA Change: L511R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: L511R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	106	473	1.9e-106	PFAM
Pfam:Abhydrolase_5	537	752	2.9e-12	PFAM
Pfam:Peptidase_S9	553	760	1.5e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152085

Predicted Effect

probably damaging
Transcript: ENSMUST00000174234
AA Change: L486R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: L486R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	82	448	4.1e-108	PFAM
Pfam:Abhydrolase_5	512	727	6.4e-12	PFAM
Pfam:Abhydrolase_6	523	711	8.9e-10	PFAM
Pfam:Peptidase_S9	528	735	5.9e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000174448
AA Change: L506R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: L506R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	101	468	2.2e-110	PFAM
Pfam:Abhydrolase_5	532	747	2.5e-12	PFAM
Pfam:Abhydrolase_6	541	731	2.4e-10	PFAM
Pfam:Peptidase_S9	548	755	1e-59	PFAM

Meta Mutation Damage Score

0.5404

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	A	G	3: 88,693,136		probably benign	Het
AA986860	A	G	1: 130,741,189		probably benign	Het
Bves	A	G	10: 45,354,811	R293G	probably damaging	Het
Ceacam1	T	C	7: 25,471,914	N375S	probably benign	Het
Celf3	T	G	3: 94,488,538	C304G	probably damaging	Het
Clcc1	T	A	3: 108,668,113	C169S	probably benign	Het
Cyth1	A	G	11: 118,192,436	V46A	probably damaging	Het
Ddx23	G	A	15: 98,650,732	T365M	probably damaging	Het
Etaa1	A	G	11: 17,953,823		probably benign	Het
Golga7b	T	C	19: 42,267,071	M129T	possibly damaging	Het
Hdac7	G	T	15: 97,808,009	Q361K	probably damaging	Het
Itk	A	G	11: 46,355,848	L181P	probably benign	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Lrp1b	A	T	2: 40,600,288	L287H	probably damaging	Het
Mei1	A	G	15: 82,098,042	Y677C	probably damaging	Het
Mslnl	T	C	17: 25,744,969	V424A	probably damaging	Het
Nbeal1	T	C	1: 60,278,780	F1959L	probably damaging	Het
Nlrp6	T	G	7: 140,926,769	V849G	probably benign	Het
Olfr524	A	G	7: 140,202,101	I223T	probably damaging	Het
Pdilt	C	A	7: 119,500,488	E186*	probably null	Het
Ppp1r27	T	A	11: 120,550,685	I90F	probably damaging	Het
Reln	A	G	5: 22,227,600	V134A	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc16a7	T	A	10: 125,294,700	K39*	probably null	Het
Sult6b1	G	A	17: 78,906,907	T29I	probably benign	Het
Tbc1d1	G	A	5: 64,286,007	R523Q	probably damaging	Het
Ttn	T	A	2: 76,745,106	I25148F	probably damaging	Het
Ush1g	T	A	11: 115,318,897	H157L	probably damaging	Het
Utp20	T	C	10: 88,782,689	K1150E	probably damaging	Het
Vmn1r7	A	G	6: 57,024,849	I142T	possibly damaging	Het

Other mutations in Fap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Fap	APN	2	62524201	missense	possibly damaging	0.82
IGL01420:Fap	APN	2	62504502	splice site	probably benign
IGL01485:Fap	APN	2	62544311	missense	possibly damaging	0.80
IGL01987:Fap	APN	2	62528676	missense	probably damaging	1.00
IGL02198:Fap	APN	2	62554798	missense	probably benign
IGL02355:Fap	APN	2	62573498	missense	probably benign	0.02
IGL02362:Fap	APN	2	62573498	missense	probably benign	0.02
IGL03227:Fap	APN	2	62530763	critical splice acceptor site	probably null
IGL03266:Fap	APN	2	62537022	missense	probably benign
IGL03369:Fap	APN	2	62503355	splice site	probably benign
IGL03406:Fap	APN	2	62542122	splice site	probably benign
mnemosyne	UTSW	2	62528714	missense	probably damaging	1.00
R1467_Fap_571	UTSW	2	62517620	missense	probably benign	0.18
R4812_Fap_496	UTSW	2	62519021	missense	probably damaging	1.00
R5661_fap_070	UTSW	2	62536963	intron	probably benign
ANU74:Fap	UTSW	2	62547769	missense	probably damaging	1.00
R0254:Fap	UTSW	2	62503402	missense	probably damaging	1.00
R0842:Fap	UTSW	2	62537001	missense	probably damaging	1.00
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1591:Fap	UTSW	2	62553857	missense	probably damaging	0.99
R1671:Fap	UTSW	2	62553835	missense	possibly damaging	0.46
R1674:Fap	UTSW	2	62519005	missense	probably benign
R1795:Fap	UTSW	2	62548589	missense	probably damaging	1.00
R1869:Fap	UTSW	2	62528727	missense	probably damaging	1.00
R2032:Fap	UTSW	2	62542237	missense	probably benign	0.43
R2136:Fap	UTSW	2	62524207	missense	possibly damaging	0.94
R3547:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3771:Fap	UTSW	2	62533010	missense	probably damaging	1.00
R3801:Fap	UTSW	2	62546650	missense	probably benign	0.04
R3910:Fap	UTSW	2	62556104	missense	probably damaging	1.00
R4306:Fap	UTSW	2	62530707	critical splice donor site	probably null
R4323:Fap	UTSW	2	62503372	missense	probably damaging	0.97
R4517:Fap	UTSW	2	62530715	missense	probably benign	0.01
R4793:Fap	UTSW	2	62544369	missense	probably damaging	1.00
R4812:Fap	UTSW	2	62519021	missense	probably damaging	1.00
R4843:Fap	UTSW	2	62544374	missense	probably damaging	1.00
R5281:Fap	UTSW	2	62532961	critical splice donor site	probably null
R5661:Fap	UTSW	2	62536963	intron	probably benign
R5696:Fap	UTSW	2	62502459	missense	probably damaging	1.00
R5750:Fap	UTSW	2	62528714	missense	probably damaging	1.00
R5898:Fap	UTSW	2	62573503	missense	probably benign
R5907:Fap	UTSW	2	62544356	missense	probably damaging	1.00
R5944:Fap	UTSW	2	62542261	missense	probably damaging	1.00
R5991:Fap	UTSW	2	62518521	missense	probably damaging	1.00
R6110:Fap	UTSW	2	62554770	missense	possibly damaging	0.91
R6270:Fap	UTSW	2	62547788	missense	probably damaging	0.98
R6505:Fap	UTSW	2	62546603	nonsense	probably null
R6631:Fap	UTSW	2	62503381	missense	probably damaging	1.00
R6896:Fap	UTSW	2	62504600	nonsense	probably null
R7138:Fap	UTSW	2	62542178	missense	probably benign	0.10
R7806:Fap	UTSW	2	62503414	missense	probably damaging	1.00
R8000:Fap	UTSW	2	62502798	critical splice donor site	probably null
R8115:Fap	UTSW	2	62519041	missense	probably benign	0.07
R8737:Fap	UTSW	2	62512433	missense	probably benign	0.00
R8899:Fap	UTSW	2	62518473	missense	probably damaging	1.00
R8924:Fap	UTSW	2	62547821	missense	probably benign
R8972:Fap	UTSW	2	62548583	missense	probably benign	0.02
R8998:Fap	UTSW	2	62537024	missense	probably benign	0.12
R8999:Fap	UTSW	2	62537024	missense	probably benign	0.12
R9418:Fap	UTSW	2	62554837	nonsense	probably null
R9521:Fap	UTSW	2	62542156	missense	probably benign
R9686:Fap	UTSW	2	62573513	missense	possibly damaging	0.86
X0017:Fap	UTSW	2	62556180	missense	probably benign	0.04
X0026:Fap	UTSW	2	62512390	missense	probably damaging	1.00
Z1176:Fap	UTSW	2	62528774	missense	possibly damaging	0.87
Z1177:Fap	UTSW	2	62502446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCAGTGTAGAGAGCGAGC -3'
(R):5'- CTTAGTCACATCAGGGCCAC -3'

Sequencing Primer
(F):5'- CTATGGAAAAGTAGATGGTCAACTG -3'
(R):5'- CCCATACAAGCCAAAGGAATTTCATG -3'

Posted On

2015-02-19