Incidental Mutation 'R3607:Traf2'
ID 269101
Institutional Source Beutler Lab
Gene Symbol Traf2
Ensembl Gene ENSMUSG00000026942
Gene Name TNF receptor-associated factor 2
Synonyms
MMRRC Submission 040671-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3607 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25407994-25436952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25420427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 141 (T141A)
Ref Sequence ENSEMBL: ENSMUSP00000109872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028311] [ENSMUST00000114234]
AlphaFold P39429
Predicted Effect probably benign
Transcript: ENSMUST00000028311
AA Change: T134A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000028311
Gene: ENSMUSG00000026942
AA Change: T134A

DomainStartEndE-ValueType
RING 34 72 3.19e-3 SMART
Pfam:zf-TRAF 178 235 1.9e-22 PFAM
MATH 356 478 3.09e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114234
AA Change: T141A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109872
Gene: ENSMUSG00000026942
AA Change: T141A

DomainStartEndE-ValueType
RING 34 79 3.42e-2 SMART
Pfam:zf-TRAF 185 242 2.4e-23 PFAM
Pfam:TRAF_BIRC3_bd 274 337 1.6e-34 PFAM
MATH 363 485 3.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151742
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Increased lethaltiy is observed with homozygous null mice. Offspring are runted and exhibit atrophic thymii and spleens with reduced numbers of lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,191,083 (GRCm39) noncoding transcript Het
Adnp2 A T 18: 80,172,284 (GRCm39) N708K probably damaging Het
Arhgef17 C A 7: 100,580,379 (GRCm39) G190W probably damaging Het
Aspm T A 1: 139,408,406 (GRCm39) M2431K probably benign Het
Aurkc A G 7: 7,005,859 (GRCm39) Y157C probably damaging Het
Bpifb1 T A 2: 154,053,485 (GRCm39) N242K possibly damaging Het
Cracr2b C T 7: 141,046,059 (GRCm39) P370S possibly damaging Het
Etv1 A G 12: 38,881,085 (GRCm39) Y66C probably damaging Het
F830016B08Rik A T 18: 60,433,780 (GRCm39) K288* probably null Het
Fam131a C T 16: 20,520,345 (GRCm39) P181L probably damaging Het
Fat2 T A 11: 55,172,511 (GRCm39) E2734V probably damaging Het
Fgfrl1 C A 5: 108,853,289 (GRCm39) T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably benign Het
Gmfg T A 7: 28,140,961 (GRCm39) probably null Het
Gtpbp8 T C 16: 44,564,119 (GRCm39) Y184C probably damaging Het
Heatr5b T C 17: 79,141,646 (GRCm39) E2G probably damaging Het
Itpr2 T G 6: 146,129,099 (GRCm39) T2005P probably damaging Het
Kmt2a G A 9: 44,760,493 (GRCm39) T485M probably damaging Het
Kng1 T C 16: 22,886,552 (GRCm39) F112L probably damaging Het
Kprp C A 3: 92,731,588 (GRCm39) Q487H unknown Het
Lctl T C 9: 64,040,475 (GRCm39) Y473H probably damaging Het
Lpin2 T A 17: 71,536,387 (GRCm39) D225E probably damaging Het
Myom2 T C 8: 15,119,775 (GRCm39) V177A probably damaging Het
Nkrf T G X: 36,153,730 (GRCm39) N184T probably benign Het
Nt5c1b A G 12: 10,427,236 (GRCm39) N329D probably damaging Het
Ogdhl T A 14: 32,057,318 (GRCm39) V308E probably damaging Het
Or14a258 A G 7: 86,034,903 (GRCm39) C322R probably benign Het
Pcnx1 T A 12: 81,975,066 (GRCm39) F791I probably damaging Het
Prkg2 G T 5: 99,095,236 (GRCm39) T616K probably damaging Het
Psmd3 C T 11: 98,581,780 (GRCm39) R302W probably damaging Het
Ptpn1 A G 2: 167,817,427 (GRCm39) S355G probably benign Het
Pxdn A G 12: 30,040,917 (GRCm39) N398D probably benign Het
Ranbp10 A G 8: 106,502,667 (GRCm39) S300P probably benign Het
Rbl1 A T 2: 157,019,153 (GRCm39) F531I probably damaging Het
Rgl3 A G 9: 21,898,987 (GRCm39) S151P probably damaging Het
Rnf213 C A 11: 119,332,802 (GRCm39) C2670* probably null Het
Tex16 T A X: 111,003,667 (GRCm39) S159T probably damaging Het
Tnfaip3 A G 10: 18,881,350 (GRCm39) I312T probably damaging Het
Trpm7 T C 2: 126,638,348 (GRCm39) probably benign Het
Usp11 T G X: 20,580,871 (GRCm39) F426L probably damaging Het
Vcan G T 13: 89,851,420 (GRCm39) T1180K probably damaging Het
Wasf1 G C 10: 40,812,380 (GRCm39) A390P unknown Het
Yif1b C T 7: 28,937,835 (GRCm39) A7V possibly damaging Het
Other mutations in Traf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Traf2 APN 2 25,410,463 (GRCm39) nonsense probably null
IGL01010:Traf2 APN 2 25,410,450 (GRCm39) nonsense probably null
IGL01063:Traf2 APN 2 25,414,931 (GRCm39) missense probably benign 0.00
IGL01146:Traf2 APN 2 25,414,931 (GRCm39) missense probably benign 0.00
IGL02114:Traf2 APN 2 25,415,004 (GRCm39) missense possibly damaging 0.50
IGL02319:Traf2 APN 2 25,426,695 (GRCm39) missense probably damaging 0.99
accessory UTSW 2 25,427,100 (GRCm39) frame shift probably null
infinitum UTSW 2 25,410,458 (GRCm39) missense probably damaging 1.00
parallel UTSW 2 25,420,427 (GRCm39) missense probably benign 0.02
R0116:Traf2 UTSW 2 25,409,621 (GRCm39) missense probably damaging 1.00
R0238:Traf2 UTSW 2 25,427,138 (GRCm39) missense possibly damaging 0.90
R0238:Traf2 UTSW 2 25,427,138 (GRCm39) missense possibly damaging 0.90
R1741:Traf2 UTSW 2 25,414,495 (GRCm39) missense probably damaging 1.00
R3605:Traf2 UTSW 2 25,420,427 (GRCm39) missense probably benign 0.02
R4940:Traf2 UTSW 2 25,420,300 (GRCm39) missense probably null 0.48
R5296:Traf2 UTSW 2 25,410,452 (GRCm39) missense probably damaging 1.00
R5784:Traf2 UTSW 2 25,429,049 (GRCm39) missense probably benign 0.32
R7536:Traf2 UTSW 2 25,427,118 (GRCm39) missense possibly damaging 0.63
R7639:Traf2 UTSW 2 25,427,100 (GRCm39) frame shift probably null
R8684:Traf2 UTSW 2 25,410,458 (GRCm39) missense probably damaging 1.00
R9650:Traf2 UTSW 2 25,410,454 (GRCm39) missense probably damaging 1.00
Z1176:Traf2 UTSW 2 25,427,156 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAACTTCAACCATGGCAG -3'
(R):5'- AGTGGCCTGTGTCTATACAGTG -3'

Sequencing Primer
(F):5'- CAGTAAATGCTAGGCGACTGC -3'
(R):5'- CCTGTGTCTATACAGTGGTTCTGAG -3'
Posted On 2015-02-19