Incidental Mutation 'R2029:Usp28'
ID269757
Institutional Source Beutler Lab
Gene Symbol Usp28
Ensembl Gene ENSMUSG00000032267
Gene Nameubiquitin specific peptidase 28
Synonyms9830148O20Rik
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2029 (G1)
Quality Score29
Status Validated
Chromosome9
Chromosomal Location48985375-49042517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48985503 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 8 (D8G)
Ref Sequence ENSEMBL: ENSMUSP00000149207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215788]
Predicted Effect probably benign
Transcript: ENSMUST00000047349
AA Change: D8G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: D8G

DomainStartEndE-ValueType
UIM 97 116 3.1e-3 SMART
Pfam:UCH 161 652 5.4e-52 PFAM
Pfam:UCH_1 162 626 2e-11 PFAM
low complexity region 695 705 N/A INTRINSIC
low complexity region 713 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213874
AA Change: D8G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect unknown
Transcript: ENSMUST00000215788
AA Change: D8G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216607
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,067,624 S68* probably null Het
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
AI314180 G A 4: 58,844,165 R534* probably null Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R58S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Ddx3y T C Y: 1,266,389 E331G probably benign Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R304* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Kdm6b C T 11: 69,403,592 G1218D unknown Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pkn1 T A 8: 83,677,963 Q496L possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Ptprb G A 10: 116,347,053 G1545S probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Skint1 G A 4: 112,021,456 probably null Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zfyve16 T C 13: 92,504,477 D1253G probably damaging Het
Zswim7 G A 11: 62,267,473 probably benign Het
Other mutations in Usp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Usp28 APN 9 49028163 missense probably benign 0.01
IGL01105:Usp28 APN 9 49010250 missense probably damaging 1.00
IGL01124:Usp28 APN 9 49037213 missense probably damaging 1.00
IGL01304:Usp28 APN 9 49026819 missense probably damaging 0.99
IGL01527:Usp28 APN 9 49025873 missense probably benign 0.02
IGL01859:Usp28 APN 9 49024021 nonsense probably null
IGL01860:Usp28 APN 9 49032243 nonsense probably null
IGL02047:Usp28 APN 9 49035641 missense probably damaging 0.99
IGL02188:Usp28 APN 9 49024009 missense probably benign 0.00
IGL02267:Usp28 APN 9 49023965 missense probably damaging 1.00
IGL02472:Usp28 APN 9 49037769 missense possibly damaging 0.95
IGL02675:Usp28 APN 9 49039091 missense possibly damaging 0.81
IGL02982:Usp28 APN 9 49018439 missense probably benign 0.00
IGL03105:Usp28 APN 9 49039055 missense probably damaging 0.99
R0100:Usp28 UTSW 9 49035932 missense probably damaging 1.00
R0114:Usp28 UTSW 9 49039023 missense probably benign 0.00
R0196:Usp28 UTSW 9 49028278 missense probably damaging 0.96
R0206:Usp28 UTSW 9 49028269 missense probably damaging 1.00
R0349:Usp28 UTSW 9 49010281 nonsense probably null
R0379:Usp28 UTSW 9 49024067 missense possibly damaging 0.58
R0454:Usp28 UTSW 9 49039101 missense possibly damaging 0.94
R0479:Usp28 UTSW 9 49037213 missense probably damaging 1.00
R0540:Usp28 UTSW 9 49024060 missense probably benign
R0726:Usp28 UTSW 9 49003869 missense probably damaging 1.00
R0835:Usp28 UTSW 9 49001524 missense probably damaging 1.00
R0928:Usp28 UTSW 9 49030891 missense possibly damaging 0.60
R1271:Usp28 UTSW 9 49035961 critical splice donor site probably null
R1534:Usp28 UTSW 9 48985506 missense possibly damaging 0.92
R1539:Usp28 UTSW 9 49037796 missense probably benign 0.07
R1687:Usp28 UTSW 9 49024017 missense probably benign 0.00
R1867:Usp28 UTSW 9 49009194 missense probably benign 0.00
R1868:Usp28 UTSW 9 49016707 missense probably damaging 1.00
R1884:Usp28 UTSW 9 49035947 missense probably damaging 1.00
R2046:Usp28 UTSW 9 49039075 missense probably damaging 1.00
R2379:Usp28 UTSW 9 49003095 missense probably null 0.94
R2404:Usp28 UTSW 9 49037258 critical splice donor site probably null
R3196:Usp28 UTSW 9 49025825 missense probably benign 0.03
R3831:Usp28 UTSW 9 49035638 missense probably benign 0.00
R3922:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3924:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3926:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3943:Usp28 UTSW 9 49000366 missense probably benign 0.12
R4834:Usp28 UTSW 9 49001536 missense probably damaging 1.00
R5041:Usp28 UTSW 9 49037773 missense probably benign
R5186:Usp28 UTSW 9 49010250 missense probably damaging 1.00
R5308:Usp28 UTSW 9 49037201 missense probably damaging 1.00
R5870:Usp28 UTSW 9 49025985 nonsense probably null
R6838:Usp28 UTSW 9 49000430 critical splice donor site probably null
R6959:Usp28 UTSW 9 49001542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTGACCCCTTAGTTTG -3'
(R):5'- GGCTTATACACCCAGGCAAC -3'

Sequencing Primer
(F):5'- ACCGGGGCTCTAAATTGGC -3'
(R):5'- TCACACAGGCTCGCGGAC -3'
Posted On2015-02-26