Mutagenetix > Incidental Mutations

Incidental Mutation 'R0928:Usp28'

80660

Institutional Source

Beutler Lab

Gene Symbol

Usp28

Ensembl Gene

ENSMUSG00000032267

Gene Name

ubiquitin specific peptidase 28

Synonyms

9830148O20Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0928 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48985375-49042517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 49030891 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 341 (S341A)

Ref Sequence

ENSEMBL: ENSMUSP00000150707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215856]

Predicted Effect

probably benign
Transcript: ENSMUST00000047349
AA Change: S718A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: S718A

Domain	Start	End	E-Value	Type
UIM	97	116	3.1e-3	SMART
Pfam:UCH	161	652	5.4e-52	PFAM
Pfam:UCH_1	162	626	2e-11	PFAM
low complexity region	695	705	N/A	INTRINSIC
low complexity region	713	730	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213457

Predicted Effect

probably benign
Transcript: ENSMUST00000213874
AA Change: S693A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215118

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215850

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215856
AA Change: S341A

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.2%
3x: 98.1%
10x: 93.0%
20x: 75.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,624,582	D745G	possibly damaging	Het
4931406P16Rik	A	T	7: 34,248,246		probably null	Het
Abca12	T	A	1: 71,349,174	D179V	probably benign	Het
Abcc1	T	C	16: 14,389,985		probably null	Het
Adad1	G	A	3: 37,076,740		probably null	Het
Apobec4	T	C	1: 152,756,277	Y19H	probably damaging	Het
Bco2	T	A	9: 50,545,931	T104S	probably damaging	Het
Bnc1	A	G	7: 81,973,502	V659A	probably benign	Het
Ccdc144b	A	C	3: 36,025,366	N258K	possibly damaging	Het
Ccs	T	C	19: 4,825,960	E184G	probably damaging	Het
Cfap70	T	G	14: 20,443,919	K97N	probably damaging	Het
Daam2	T	C	17: 49,488,227	I313V	probably benign	Het
Dach1	T	C	14: 97,915,832	S467G	probably damaging	Het
Dnah11	A	G	12: 118,045,562	S2122P	probably damaging	Het
Dnah3	T	A	7: 120,030,051	D1427V	probably damaging	Het
Dnaic1	T	C	4: 41,602,566	F97L	possibly damaging	Het
Dsc1	A	T	18: 20,110,249		probably null	Het
En2	A	T	5: 28,170,331	K291*	probably null	Het
Eps15	T	C	4: 109,312,963	V154A	possibly damaging	Het
Etnk1	A	G	6: 143,184,703	I183V	probably benign	Het
Fcrlb	A	T	1: 170,907,940	V255D	possibly damaging	Het
Fry	A	T	5: 150,437,084	E52V	probably damaging	Het
Gm8251	C	A	1: 44,057,228	S1570I	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,885	Y152C	probably damaging	Het
Hao1	C	A	2: 134,505,616	L256F	possibly damaging	Het
Helz	T	A	11: 107,626,693	I685K	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Izumo2	A	T	7: 44,715,423	I171F	possibly damaging	Het
Krt83	C	A	15: 101,491,280	C57F	probably benign	Het
Mapkbp1	A	G	2: 120,015,368	H400R	probably benign	Het
Megf6	T	A	4: 154,177,047	V43E	probably damaging	Het
Mut	T	C	17: 40,937,283	I67T	probably benign	Het
Ninl	A	T	2: 150,963,475	V396E	probably damaging	Het
Nvl	A	T	1: 181,093,902	V844E	probably benign	Het
Olfr11	C	T	13: 21,638,956	C189Y	probably damaging	Het
P2rx3	A	T	2: 85,035,298	M1K	probably null	Het
Pabpn1l	T	C	8: 122,622,619	T20A	probably benign	Het
Ppp3r2	C	A	4: 49,681,439		probably null	Het
Prmt6	C	T	3: 110,250,682	G97D	probably damaging	Het
Prmt9	T	C	8: 77,581,176	V823A	probably damaging	Het
Skint11	C	A	4: 114,244,601	D79E	possibly damaging	Het
Slc17a8	T	A	10: 89,598,683	H194L	probably damaging	Het
Slco6c1	T	A	1: 97,104,848	I293F	possibly damaging	Het
Tcl1b4	A	T	12: 105,202,606	H43L	probably benign	Het
Tm9sf1	T	C	14: 55,636,457	D528G	probably damaging	Het
Tpbpb	C	T	13: 60,902,175	V47I	probably benign	Het
Ttc37	T	G	13: 76,113,592	L142W	probably damaging	Het
Ttn	G	T	2: 76,907,532		probably benign	Het
Vwa5a	T	C	9: 38,728,007	Y345H	probably damaging	Het
Wdr11	C	A	7: 129,606,653	D377E	probably damaging	Het
Zer1	A	G	2: 30,101,763		probably null	Het

Other mutations in Usp28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Usp28	APN	9	49028163	missense	probably benign	0.01
IGL01105:Usp28	APN	9	49010250	missense	probably damaging	1.00
IGL01124:Usp28	APN	9	49037213	missense	probably damaging	1.00
IGL01304:Usp28	APN	9	49026819	missense	probably damaging	0.99
IGL01527:Usp28	APN	9	49025873	missense	probably benign	0.02
IGL01859:Usp28	APN	9	49024021	nonsense	probably null
IGL01860:Usp28	APN	9	49032243	nonsense	probably null
IGL02047:Usp28	APN	9	49035641	missense	probably damaging	0.99
IGL02188:Usp28	APN	9	49024009	missense	probably benign	0.00
IGL02267:Usp28	APN	9	49023965	missense	probably damaging	1.00
IGL02472:Usp28	APN	9	49037769	missense	possibly damaging	0.95
IGL02675:Usp28	APN	9	49039091	missense	possibly damaging	0.81
IGL02982:Usp28	APN	9	49018439	missense	probably benign	0.00
IGL03105:Usp28	APN	9	49039055	missense	probably damaging	0.99
R0100:Usp28	UTSW	9	49035932	missense	probably damaging	1.00
R0114:Usp28	UTSW	9	49039023	missense	probably benign	0.00
R0196:Usp28	UTSW	9	49028278	missense	probably damaging	0.96
R0206:Usp28	UTSW	9	49028269	missense	probably damaging	1.00
R0349:Usp28	UTSW	9	49010281	nonsense	probably null
R0379:Usp28	UTSW	9	49024067	missense	possibly damaging	0.58
R0454:Usp28	UTSW	9	49039101	missense	possibly damaging	0.94
R0479:Usp28	UTSW	9	49037213	missense	probably damaging	1.00
R0540:Usp28	UTSW	9	49024060	missense	probably benign
R0726:Usp28	UTSW	9	49003869	missense	probably damaging	1.00
R0835:Usp28	UTSW	9	49001524	missense	probably damaging	1.00
R1271:Usp28	UTSW	9	49035961	critical splice donor site	probably null
R1534:Usp28	UTSW	9	48985506	missense	possibly damaging	0.92
R1539:Usp28	UTSW	9	49037796	missense	probably benign	0.07
R1687:Usp28	UTSW	9	49024017	missense	probably benign	0.00
R1867:Usp28	UTSW	9	49009194	missense	probably benign	0.00
R1868:Usp28	UTSW	9	49016707	missense	probably damaging	1.00
R1884:Usp28	UTSW	9	49035947	missense	probably damaging	1.00
R2029:Usp28	UTSW	9	48985503	missense	probably benign	0.22
R2046:Usp28	UTSW	9	49039075	missense	probably damaging	1.00
R2379:Usp28	UTSW	9	49003095	missense	probably null	0.94
R2404:Usp28	UTSW	9	49037258	critical splice donor site	probably null
R3196:Usp28	UTSW	9	49025825	missense	probably benign	0.03
R3831:Usp28	UTSW	9	49035638	missense	probably benign	0.00
R3922:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3924:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3926:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3943:Usp28	UTSW	9	49000366	missense	probably benign	0.12
R4834:Usp28	UTSW	9	49001536	missense	probably damaging	1.00
R5041:Usp28	UTSW	9	49037773	missense	probably benign
R5186:Usp28	UTSW	9	49010250	missense	probably damaging	1.00
R5308:Usp28	UTSW	9	49037201	missense	probably damaging	1.00
R5870:Usp28	UTSW	9	49025985	nonsense	probably null
R6838:Usp28	UTSW	9	49000430	critical splice donor site	probably null
R6959:Usp28	UTSW	9	49001542	missense	probably damaging	1.00
R7058:Usp28	UTSW	9	49039156	missense	probably damaging	1.00
R7348:Usp28	UTSW	9	49030877	missense	probably benign	0.19
R7766:Usp28	UTSW	9	49035883	missense	probably damaging	1.00
R7814:Usp28	UTSW	9	49003918	missense	probably benign	0.01
R7828:Usp28	UTSW	9	49003902	missense	possibly damaging	0.95
Z1176:Usp28	UTSW	9	49035925	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTGCCCTGCCTCTGGGATAATG -3'
(R):5'- GGACAGCCACTATAAACAGAACCTGATG -3'

Sequencing Primer
(F):5'- TAACTATTTTCCCTCAGAGGCATC -3'
(R):5'- gttcccaagcctgatgacc -3'

Posted On

2013-11-07