Incidental Mutation 'R2029:AI314180'
ID220917
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R2029 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 58844165 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 534 (R534*)
Ref Sequence ENSEMBL: ENSMUSP00000117585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000144512] [ENSMUST00000149301]
Predicted Effect probably null
Transcript: ENSMUST00000102889
AA Change: R534*
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: R534*

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107557
AA Change: R534*
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: R534*

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144512
AA Change: R534*
SMART Domains Protein: ENSMUSP00000118103
Gene: ENSMUSG00000050812
AA Change: R534*

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 2.3e-164 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149301
AA Change: R534*
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: R534*

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151869
Meta Mutation Damage Score 0.6408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,067,624 S68* probably null Het
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R58S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Ddx3y T C Y: 1,266,389 E331G probably benign Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R304* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Kdm6b C T 11: 69,403,592 G1218D unknown Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pkn1 T A 8: 83,677,963 Q496L possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Ptprb G A 10: 116,347,053 G1545S probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Skint1 G A 4: 112,021,456 probably null Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Usp28 A G 9: 48,985,503 D8G probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zfyve16 T C 13: 92,504,477 D1253G probably damaging Het
Zswim7 G A 11: 62,267,473 probably benign Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGACACCTGGTACCCTTAAGAAC -3'
(R):5'- CAAGCCAAGTGACTCAGCAG -3'

Sequencing Primer
(F):5'- CTTTGGAAAAGCAAATTAACTGCATG -3'
(R):5'- AGTGACTCAGCAGATATCACTG -3'
Posted On2014-08-25