Incidental Mutation 'R0331:Acot12'
ID26086
Institutional Source Beutler Lab
Gene Symbol Acot12
Ensembl Gene ENSMUSG00000021620
Gene Nameacyl-CoA thioesterase 12
SynonymsCach, 1300004O04Rik, 4930449F15Rik
MMRRC Submission 038540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0331 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91741512-91786148 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 91760064 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022120]
Predicted Effect probably null
Transcript: ENSMUST00000022120
SMART Domains Protein: ENSMUSP00000022120
Gene: ENSMUSG00000021620

DomainStartEndE-ValueType
Pfam:4HBT 25 97 4.2e-12 PFAM
Pfam:4HBT 198 275 2.5e-14 PFAM
low complexity region 317 328 N/A INTRINSIC
Pfam:START 350 515 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161337
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,229,392 T79S probably benign Het
Abtb1 T C 6: 88,840,702 probably benign Het
Adamts4 T A 1: 171,250,972 S54T probably benign Het
Adgrl4 T C 3: 151,497,940 S96P probably benign Het
Aip G T 19: 4,118,247 T40K probably damaging Het
Anapc4 A G 5: 52,855,642 probably benign Het
Asz1 A G 6: 18,103,619 probably benign Het
Atf7ip A G 6: 136,561,163 T465A possibly damaging Het
Atp11a C T 8: 12,816,953 Q127* probably null Het
Axin1 A G 17: 26,143,107 R142G probably damaging Het
B230359F08Rik A G 14: 53,795,748 N38S probably benign Het
Bcat1 T A 6: 145,047,314 E86V probably benign Het
Brd4 G A 17: 32,202,515 P749L probably benign Het
C1ra G A 6: 124,519,435 probably null Het
Capza2 A T 6: 17,665,103 N237I probably benign Het
Cd2ap A T 17: 42,805,301 V556E probably benign Het
Cfap65 G A 1: 74,929,301 P124L probably damaging Het
Cfap65 G T 1: 74,929,302 P124T probably damaging Het
Cftr T C 6: 18,235,226 V488A possibly damaging Het
Ckmt1 A T 2: 121,362,856 probably null Het
Cmya5 T G 13: 93,144,403 E35A possibly damaging Het
Col7a1 A G 9: 108,967,502 probably benign Het
Crmp1 C T 5: 37,265,313 L155F possibly damaging Het
Cyp2d10 T A 15: 82,407,026 T33S probably benign Het
Dhdh T C 7: 45,488,120 K48E probably benign Het
Dlst T C 12: 85,118,812 V103A probably damaging Het
Dohh C T 10: 81,387,812 T233I probably benign Het
Dvl2 C A 11: 70,006,217 probably benign Het
Eipr1 C T 12: 28,864,704 Q286* probably null Het
Enpp6 C A 8: 47,082,449 T343K probably damaging Het
Fbxw11 T A 11: 32,711,895 F112I probably damaging Het
Gdpd4 T A 7: 97,973,008 N231K probably benign Het
Gm6370 A T 5: 146,493,766 T254S probably benign Het
Hapln4 G T 8: 70,084,509 Q31H probably damaging Het
Hic1 T A 11: 75,165,490 T858S possibly damaging Het
Isg20l2 T C 3: 87,931,785 L101P probably damaging Het
Itga10 T C 3: 96,652,483 Y485H probably damaging Het
Itgal T A 7: 127,306,681 probably null Het
Itln1 T C 1: 171,531,549 N62S probably damaging Het
Kdm4b T C 17: 56,386,289 probably benign Het
Lct T C 1: 128,298,742 probably benign Het
Lman2 A T 13: 55,353,016 H123Q probably damaging Het
Lztr1 T A 16: 17,524,237 probably benign Het
Myo3b G T 2: 70,095,261 G24V probably damaging Het
Nacad T A 11: 6,599,441 Q1250L possibly damaging Het
Ncor2 A T 5: 125,084,917 M431K unknown Het
Nek9 T A 12: 85,327,375 probably benign Het
Neu1 C A 17: 34,934,170 N255K possibly damaging Het
Nf2 T A 11: 4,794,914 T75S probably benign Het
Nipal4 T A 11: 46,150,213 D385V probably damaging Het
Olah T A 2: 3,342,474 N245I probably damaging Het
Olfr474 G T 7: 107,954,870 L76F probably benign Het
Pag1 T A 3: 9,701,970 T90S probably benign Het
Pald1 A G 10: 61,340,929 probably null Het
Parva A G 7: 112,544,798 M98V probably benign Het
Paxbp1 T A 16: 91,037,367 D177V possibly damaging Het
Paxip1 A G 5: 27,765,232 I587T probably damaging Het
Pclo T C 5: 14,680,376 probably benign Het
Pdgfra T A 5: 75,195,052 D1074E probably damaging Het
Pef1 A T 4: 130,127,448 D265V probably damaging Het
Plekhh2 G A 17: 84,586,366 E870K possibly damaging Het
Plscr4 G A 9: 92,482,642 G40D probably damaging Het
Psg18 A G 7: 18,353,308 Y142H probably benign Het
Ptchd3 A T 11: 121,842,191 M636L probably benign Het
Rab2a A G 4: 8,572,559 D51G probably benign Het
Rnf139 T A 15: 58,899,906 D593E probably benign Het
Sept7 A G 9: 25,306,256 N422S probably benign Het
Shprh T C 10: 11,194,170 probably benign Het
Slc7a6os A G 8: 106,210,567 I87T probably damaging Het
Slc7a7 A G 14: 54,377,924 probably benign Het
Spc24 G T 9: 21,757,313 N129K possibly damaging Het
Strip2 C T 6: 29,926,560 T148I probably benign Het
Tmem150c A C 5: 100,086,273 probably null Het
Ttn G T 2: 76,811,020 Y11801* probably null Het
Usp37 A T 1: 74,454,064 L688* probably null Het
Usp38 T C 8: 80,995,840 I351V probably benign Het
Vav2 T A 2: 27,296,175 M223L probably benign Het
Wdr36 A G 18: 32,852,915 I557M possibly damaging Het
Wwc2 A T 8: 47,880,204 M259K probably benign Het
Znfx1 G A 2: 167,046,978 S770L probably benign Het
Other mutations in Acot12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Acot12 APN 13 91781211 nonsense probably null
IGL01114:Acot12 APN 13 91757592 splice site probably benign
IGL01376:Acot12 APN 13 91784671 missense probably damaging 0.98
IGL01474:Acot12 APN 13 91772783 missense possibly damaging 0.53
IGL02206:Acot12 APN 13 91759987 missense probably damaging 1.00
IGL02999:Acot12 APN 13 91759981 missense probably damaging 0.97
IGL03237:Acot12 APN 13 91781269 missense probably benign 0.26
R0071:Acot12 UTSW 13 91781174 splice site probably benign
R0092:Acot12 UTSW 13 91741565 missense probably damaging 1.00
R0141:Acot12 UTSW 13 91771828 missense probably benign 0.02
R0525:Acot12 UTSW 13 91760067 splice site probably benign
R0544:Acot12 UTSW 13 91784656 missense probably benign 0.02
R1509:Acot12 UTSW 13 91771875 critical splice donor site probably null
R1616:Acot12 UTSW 13 91772767 missense probably benign 0.02
R1773:Acot12 UTSW 13 91757557 missense probably benign 0.27
R1897:Acot12 UTSW 13 91784397 missense probably benign
R2047:Acot12 UTSW 13 91783003 missense probably damaging 1.00
R2102:Acot12 UTSW 13 91759977 missense probably benign 0.00
R3730:Acot12 UTSW 13 91760026 missense possibly damaging 0.61
R3735:Acot12 UTSW 13 91784346 missense probably benign
R3736:Acot12 UTSW 13 91784346 missense probably benign
R3912:Acot12 UTSW 13 91770089 missense probably benign 0.01
R4156:Acot12 UTSW 13 91784763 missense probably benign 0.00
R4418:Acot12 UTSW 13 91784405 missense possibly damaging 0.46
R4879:Acot12 UTSW 13 91762964 missense probably benign 0.17
R5456:Acot12 UTSW 13 91741640 missense probably damaging 1.00
R5498:Acot12 UTSW 13 91781233 missense probably damaging 1.00
R5601:Acot12 UTSW 13 91782910 missense probably benign 0.10
R5998:Acot12 UTSW 13 91757534 missense possibly damaging 0.49
R6781:Acot12 UTSW 13 91784412 splice site probably null
R7208:Acot12 UTSW 13 91781242 missense probably benign 0.06
R7330:Acot12 UTSW 13 91741532 start codon destroyed probably null 0.89
R7560:Acot12 UTSW 13 91784391 missense probably benign
R7561:Acot12 UTSW 13 91770124 missense probably damaging 0.96
X0050:Acot12 UTSW 13 91771837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTTGGAGACGTGTGTGACG -3'
(R):5'- AGCTCACTGACTCAGCATCTTTGAC -3'

Sequencing Primer
(F):5'- ACGCAGTTGAATCTATTGTCAGG -3'
(R):5'- GTGACTGGACCATGACTTTCAAC -3'
Posted On2013-04-16