Incidental Mutation 'R3807:Tdp2'
ID274990
Institutional Source Beutler Lab
Gene Symbol Tdp2
Ensembl Gene ENSMUSG00000035958
Gene Nametyrosyl-DNA phosphodiesterase 2
SynonymsD13Ertd656e, Ttrap
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24831679-24842153 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 24831793 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 21 (S21*)
Ref Sequence ENSEMBL: ENSMUSP00000153301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006900] [ENSMUST00000038039] [ENSMUST00000223804] [ENSMUST00000225138]
Predicted Effect probably benign
Transcript: ENSMUST00000006900
SMART Domains Protein: ENSMUSP00000006900
Gene: ENSMUSG00000006717

DomainStartEndE-ValueType
Pfam:4HBT 52 129 1.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038039
AA Change: S21*
SMART Domains Protein: ENSMUSP00000035660
Gene: ENSMUSG00000035958
AA Change: S21*

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Pfam:Exo_endo_phos 127 359 3.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130788
Predicted Effect probably null
Transcript: ENSMUST00000223804
AA Change: S21*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224839
Predicted Effect probably null
Transcript: ENSMUST00000225138
AA Change: S21*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226055
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a superfamily of divalent cation-dependent phosphodiesterases. The encoded protein associates with CD40, tumor necrosis factor (TNF) receptor-75 and TNF receptor associated factors (TRAFs), and inhibits nuclear factor-kappa-B activation. This protein has sequence and structural similarities with APE1 endonuclease, which is involved in both DNA repair and the activation of transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice carrying a gene trap insertion into intron 5 but subsequently shown to harbor a partial duplication of the wild-type allele at the ES cell level are born with a normal Mendelian distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Tdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Tdp2 APN 13 24840538 missense probably damaging 1.00
IGL01376:Tdp2 APN 13 24836949 splice site probably null
IGL02346:Tdp2 APN 13 24841352 missense possibly damaging 0.86
IGL02455:Tdp2 APN 13 24841262 missense probably damaging 0.97
R0008:Tdp2 UTSW 13 24841350 splice site probably null
R0008:Tdp2 UTSW 13 24841350 splice site probably null
R0164:Tdp2 UTSW 13 24838239 missense probably damaging 1.00
R0164:Tdp2 UTSW 13 24838239 missense probably damaging 1.00
R0179:Tdp2 UTSW 13 24840448 missense possibly damaging 0.46
R1939:Tdp2 UTSW 13 24841277 missense probably benign 0.07
R3955:Tdp2 UTSW 13 24836099 missense probably benign 0.00
R4943:Tdp2 UTSW 13 24838265 missense probably benign 0.02
R5044:Tdp2 UTSW 13 24831826 missense probably benign 0.00
R5529:Tdp2 UTSW 13 24838236 nonsense probably null
R5827:Tdp2 UTSW 13 24831853 missense probably damaging 0.99
R6235:Tdp2 UTSW 13 24840395 nonsense probably null
R6326:Tdp2 UTSW 13 24840557 missense probably damaging 1.00
R7091:Tdp2 UTSW 13 24838224 missense probably damaging 1.00
R7244:Tdp2 UTSW 13 24841301 missense probably benign 0.02
R7341:Tdp2 UTSW 13 24832076 missense probably benign 0.00
R8010:Tdp2 UTSW 13 24836027 missense probably damaging 1.00
Z1177:Tdp2 UTSW 13 24841251 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATCACGGGTTACCTTCAC -3'
(R):5'- CTTTCTGAAAAGCAAAGGCACAAG -3'

Sequencing Primer
(F):5'- CGGTCTTCTTGCCGGAAG -3'
(R):5'- GGCACAAGGCTGCAGGG -3'
Posted On2015-04-02