Incidental Mutation 'R8010:Tdp2'
ID616871
Institutional Source Beutler Lab
Gene Symbol Tdp2
Ensembl Gene ENSMUSG00000035958
Gene Nametyrosyl-DNA phosphodiesterase 2
SynonymsD13Ertd656e, Ttrap
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location24831679-24842153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24836027 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 99 (T99I)
Ref Sequence ENSEMBL: ENSMUSP00000035660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006900] [ENSMUST00000038039] [ENSMUST00000223804] [ENSMUST00000225138]
PDB Structure
Mus Musculus Tdp2 Bound to dAMP and Mg2+ [X-RAY DIFFRACTION]
Mus Musculus Tdp2-DNA Substrate Analog (5'-6-aminohexanol) Complex [X-RAY DIFFRACTION]
Mus Musculus Tdp2 reaction product (5'-phosphorylated DNA)-Mg2+ complex at 1.5 Angstroms resolution [X-RAY DIFFRACTION]
Mus Musculus Tdp2 excluded ssDNA complex [X-RAY DIFFRACTION]
Mus Musculus Tdp2 reaction product complex with 5'-phosphorylated RNA/DNA, glycerol, and Mg2+ [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006900
SMART Domains Protein: ENSMUSP00000006900
Gene: ENSMUSG00000006717

DomainStartEndE-ValueType
Pfam:4HBT 52 129 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038039
AA Change: T99I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035660
Gene: ENSMUSG00000035958
AA Change: T99I

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Pfam:Exo_endo_phos 127 359 3.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223804
Predicted Effect probably benign
Transcript: ENSMUST00000225138
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a superfamily of divalent cation-dependent phosphodiesterases. The encoded protein associates with CD40, tumor necrosis factor (TNF) receptor-75 and TNF receptor associated factors (TRAFs), and inhibits nuclear factor-kappa-B activation. This protein has sequence and structural similarities with APE1 endonuclease, which is involved in both DNA repair and the activation of transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice carrying a gene trap insertion into intron 5 but subsequently shown to harbor a partial duplication of the wild-type allele at the ES cell level are born with a normal Mendelian distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Tdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Tdp2 APN 13 24840538 missense probably damaging 1.00
IGL01376:Tdp2 APN 13 24836949 splice site probably null
IGL02346:Tdp2 APN 13 24841352 missense possibly damaging 0.86
IGL02455:Tdp2 APN 13 24841262 missense probably damaging 0.97
R0008:Tdp2 UTSW 13 24841350 splice site probably null
R0008:Tdp2 UTSW 13 24841350 splice site probably null
R0164:Tdp2 UTSW 13 24838239 missense probably damaging 1.00
R0164:Tdp2 UTSW 13 24838239 missense probably damaging 1.00
R0179:Tdp2 UTSW 13 24840448 missense possibly damaging 0.46
R1939:Tdp2 UTSW 13 24841277 missense probably benign 0.07
R3807:Tdp2 UTSW 13 24831793 nonsense probably null
R3955:Tdp2 UTSW 13 24836099 missense probably benign 0.00
R4943:Tdp2 UTSW 13 24838265 missense probably benign 0.02
R5044:Tdp2 UTSW 13 24831826 missense probably benign 0.00
R5529:Tdp2 UTSW 13 24838236 nonsense probably null
R5827:Tdp2 UTSW 13 24831853 missense probably damaging 0.99
R6235:Tdp2 UTSW 13 24840395 nonsense probably null
R6326:Tdp2 UTSW 13 24840557 missense probably damaging 1.00
R7091:Tdp2 UTSW 13 24838224 missense probably damaging 1.00
R7244:Tdp2 UTSW 13 24841301 missense probably benign 0.02
R7341:Tdp2 UTSW 13 24832076 missense probably benign 0.00
Z1177:Tdp2 UTSW 13 24841251 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTCGTAGACAATTTAGAAGGTGG -3'
(R):5'- TCCCTACCATGGAAAAGAGAATGC -3'

Sequencing Primer
(F):5'- CTCTACATTTGGAAGCCAGAGGTC -3'
(R):5'- CTTACAAAGCTAGGCAGGAACAC -3'
Posted On2020-01-23