Incidental Mutation 'R3809:Slc2a3'
ID275099
Institutional Source Beutler Lab
Gene Symbol Slc2a3
Ensembl Gene ENSMUSG00000003153
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 3
SynonymsGlut-3, Glut3
MMRRC Submission 040766-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3809 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122727809-122801640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122732429 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 337 (I337T)
Ref Sequence ENSEMBL: ENSMUSP00000032476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032476] [ENSMUST00000165884] [ENSMUST00000166135] [ENSMUST00000171541]
Predicted Effect probably benign
Transcript: ENSMUST00000032476
AA Change: I337T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032476
Gene: ENSMUSG00000003153
AA Change: I337T

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 465 5.9e-165 PFAM
Pfam:MFS_1 16 385 7.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165884
SMART Domains Protein: ENSMUSP00000129925
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:MFS_1 13 163 3.6e-12 PFAM
Pfam:Sugar_tr 15 163 6.9e-49 PFAM
Pfam:MFS_2 43 148 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166135
SMART Domains Protein: ENSMUSP00000132586
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 63 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169979
Predicted Effect probably benign
Transcript: ENSMUST00000171541
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutations cause embryonic lethality. Heterozygotes for a null allele show partial perinatal lethality and impaired placental transport. Heterozygotes for a gene trap allele show abnormal brain wave patterns, increased startle reflex, reduced prepulse inhibition and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,693 Y105C possibly damaging Het
Apol7e A T 15: 77,718,062 T287S probably benign Het
Arhgap12 A T 18: 6,037,057 N561K probably benign Het
Armc3 G T 2: 19,300,665 A757S probably damaging Het
Baz2b A T 2: 59,968,896 S295T probably benign Het
Brd4 T A 17: 32,211,270 K686N possibly damaging Het
Btnl6 T C 17: 34,508,228 T443A probably benign Het
Cacna1g T C 11: 94,416,096 T1801A probably damaging Het
Celsr2 G A 3: 108,403,239 T1509I possibly damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Cog1 G T 11: 113,655,010 M370I probably benign Het
Col6a6 C G 9: 105,780,692 V774L probably damaging Het
Csf1r T A 18: 61,112,764 S264R probably benign Het
Ctnna2 A T 6: 76,954,757 V620D probably damaging Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Frmd4b G A 6: 97,323,729 L214F possibly damaging Het
Fstl1 T A 16: 37,826,751 L161Q probably damaging Het
Hdac1 A G 4: 129,524,320 F94S probably damaging Het
Hlf T C 11: 90,388,103 D45G probably benign Het
Hps3 A T 3: 20,018,812 M501K probably damaging Het
Ighv14-4 A G 12: 114,176,554 Y79H probably damaging Het
Ip6k1 T A 9: 108,045,887 V406D probably damaging Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Itga11 A G 9: 62,771,382 T944A probably benign Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Kmt2c T C 5: 25,409,138 R195G possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Neb A G 2: 52,256,789 I2821T possibly damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr447 A T 6: 42,912,337 K271N probably damaging Het
Olfr657 A T 7: 104,636,333 I220L possibly damaging Het
Olfr918 C T 9: 38,672,863 V207I probably benign Het
Papd7 A G 13: 69,512,996 V51A probably damaging Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Pfdn1 C T 18: 36,451,092 G63D probably damaging Het
Pgghg T C 7: 140,945,295 F405L probably damaging Het
Plcd3 T C 11: 103,101,383 M50V probably null Het
Plekha8 C A 6: 54,619,349 S198R probably benign Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rnf217 T A 10: 31,503,808 I473F possibly damaging Het
Sec16a G C 2: 26,441,813 N63K possibly damaging Het
Sik3 A G 9: 46,219,486 D1240G probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tinag C T 9: 76,951,905 D474N probably benign Het
Ublcp1 A G 11: 44,458,282 F242L probably benign Het
Ucp1 C A 8: 83,290,641 A20D probably damaging Het
Ugt1a7c C T 1: 88,095,382 R88W possibly damaging Het
Wipf3 A G 6: 54,481,795 D45G probably damaging Het
Zfp592 G A 7: 81,024,532 A415T probably benign Het
Other mutations in Slc2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Slc2a3 APN 6 122729956 missense probably benign
IGL02056:Slc2a3 APN 6 122735478 missense probably damaging 0.99
IGL02267:Slc2a3 APN 6 122739972 missense probably benign 0.00
IGL02873:Slc2a3 APN 6 122740414 missense probably damaging 0.98
IGL03275:Slc2a3 APN 6 122736742 critical splice acceptor site probably null
R1014:Slc2a3 UTSW 6 122731566 missense possibly damaging 0.77
R1464:Slc2a3 UTSW 6 122737310 splice site probably benign
R1920:Slc2a3 UTSW 6 122736741 missense probably damaging 0.99
R1990:Slc2a3 UTSW 6 122736735 missense probably damaging 1.00
R4094:Slc2a3 UTSW 6 122735568 missense probably benign 0.23
R4537:Slc2a3 UTSW 6 122737104 missense probably damaging 1.00
R5093:Slc2a3 UTSW 6 122737237 missense probably damaging 0.99
R5186:Slc2a3 UTSW 6 122735583 missense probably damaging 1.00
R5784:Slc2a3 UTSW 6 122735417 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAATCGACATTTCATGCAGTGC -3'
(R):5'- TCAGTCACTCAGAAGCTGTGG -3'

Sequencing Primer
(F):5'- TTCATGCAGTGCAATGATACCC -3'
(R):5'- TCACTCAGAAGCTGTGGAACGG -3'
Posted On2015-04-02