Mutagenetix > Incidental Mutations

Incidental Mutation 'R3809:Tinag'

275111

Institutional Source

Beutler Lab

Gene Symbol

Tinag

Ensembl Gene

ENSMUSG00000032357

Gene Name

tubulointerstitial nephritis antigen

Synonyms

TIN-ag

MMRRC Submission

040766-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R3809 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76951693-77045794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 76951905 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 474 (D474N)

Ref Sequence

ENSEMBL: ENSMUSP00000034911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]

AlphaFold

Q9WUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000034911
AA Change: D474N

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: D474N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART
Pept_C1	216	466	1.83e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184897

SMART Domains

Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
3425401B19Rik	T	C	14: 32,663,693	Y105C	possibly damaging	Het
Apol7e	A	T	15: 77,718,062	T287S	probably benign	Het
Arhgap12	A	T	18: 6,037,057	N561K	probably benign	Het
Armc3	G	T	2: 19,300,665	A757S	probably damaging	Het
Baz2b	A	T	2: 59,968,896	S295T	probably benign	Het
Brd4	T	A	17: 32,211,270	K686N	possibly damaging	Het
Btnl6	T	C	17: 34,508,228	T443A	probably benign	Het
Cacna1g	T	C	11: 94,416,096	T1801A	probably damaging	Het
Celsr2	G	A	3: 108,403,239	T1509I	possibly damaging	Het
Cers1	A	G	8: 70,330,010	D10G	possibly damaging	Het
Cntnap3	A	G	13: 64,781,804	V527A	probably damaging	Het
Cog1	G	T	11: 113,655,010	M370I	probably benign	Het
Col6a6	C	G	9: 105,780,692	V774L	probably damaging	Het
Csf1r	T	A	18: 61,112,764	S264R	probably benign	Het
Ctnna2	A	T	6: 76,954,757	V620D	probably damaging	Het
Eif2b4	A	G	5: 31,191,168	S88P	possibly damaging	Het
Frmd4b	G	A	6: 97,323,729	L214F	possibly damaging	Het
Fstl1	T	A	16: 37,826,751	L161Q	probably damaging	Het
Hdac1	A	G	4: 129,524,320	F94S	probably damaging	Het
Hlf	T	C	11: 90,388,103	D45G	probably benign	Het
Hps3	A	T	3: 20,018,812	M501K	probably damaging	Het
Ighv14-4	A	G	12: 114,176,554	Y79H	probably damaging	Het
Ip6k1	T	A	9: 108,045,887	V406D	probably damaging	Het
Iqcf1	T	C	9: 106,501,878	S29P	probably benign	Het
Itga11	A	G	9: 62,771,382	T944A	probably benign	Het
Kcnj12	A	G	11: 61,070,277	N467S	probably benign	Het
Klhdc3	T	A	17: 46,677,932	N111Y	possibly damaging	Het
Kmt2c	T	C	5: 25,409,138	R195G	possibly damaging	Het
Lin9	A	G	1: 180,659,111	I81V	probably null	Het
Lrp2	T	C	2: 69,501,548	D1621G	probably damaging	Het
Med15	C	T	16: 17,655,734		probably benign	Het
Neb	A	G	2: 52,256,789	I2821T	possibly damaging	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr127	T	C	17: 37,903,573	V9A	probably benign	Het
Olfr447	A	T	6: 42,912,337	K271N	probably damaging	Het
Olfr657	A	T	7: 104,636,333	I220L	possibly damaging	Het
Olfr918	C	T	9: 38,672,863	V207I	probably benign	Het
Papd7	A	G	13: 69,512,996	V51A	probably damaging	Het
Paxip1	A	G	5: 27,772,029		probably benign	Het
Pfas	T	C	11: 68,989,953		probably benign	Het
Pfdn1	C	T	18: 36,451,092	G63D	probably damaging	Het
Pgghg	T	C	7: 140,945,295	F405L	probably damaging	Het
Plcd3	T	C	11: 103,101,383	M50V	probably null	Het
Plekha8	C	A	6: 54,619,349	S198R	probably benign	Het
Ppp4c	C	T	7: 126,787,327	G166D	probably damaging	Het
Rassf2	T	C	2: 131,998,260		probably null	Het
Rnf217	T	A	10: 31,503,808	I473F	possibly damaging	Het
Sec16a	G	C	2: 26,441,813	N63K	possibly damaging	Het
Sik3	A	G	9: 46,219,486	D1240G	probably benign	Het
Slamf1	A	G	1: 171,798,177	D307G	probably null	Het
Slc2a3	A	G	6: 122,732,429	I337T	probably benign	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Ublcp1	A	G	11: 44,458,282	F242L	probably benign	Het
Ucp1	C	A	8: 83,290,641	A20D	probably damaging	Het
Ugt1a7c	C	T	1: 88,095,382	R88W	possibly damaging	Het
Wipf3	A	G	6: 54,481,795	D45G	probably damaging	Het
Zfp592	G	A	7: 81,024,532	A415T	probably benign	Het

Other mutations in Tinag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Tinag	APN	9	77045576	missense	possibly damaging	0.93
IGL01524:Tinag	APN	9	77045538	missense	probably damaging	1.00
IGL01537:Tinag	APN	9	77045603	missense	probably benign	0.01
IGL01832:Tinag	APN	9	77031756	missense	probably benign	0.18
IGL02512:Tinag	APN	9	77031787	splice site	probably benign
IGL02888:Tinag	APN	9	77031713	missense	probably benign	0.24
G1citation:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R0179:Tinag	UTSW	9	76996882	splice site	probably benign
R0200:Tinag	UTSW	9	76951935	missense	probably damaging	1.00
R0206:Tinag	UTSW	9	76999852	missense	probably damaging	1.00
R0545:Tinag	UTSW	9	77031710	missense	possibly damaging	0.61
R0666:Tinag	UTSW	9	77005687	missense	probably benign	0.02
R0685:Tinag	UTSW	9	76952003	missense	probably damaging	1.00
R0732:Tinag	UTSW	9	77001654	missense	possibly damaging	0.93
R1445:Tinag	UTSW	9	77045516	missense	probably damaging	1.00
R2318:Tinag	UTSW	9	77045411	missense	probably damaging	1.00
R4747:Tinag	UTSW	9	76996956	missense	probably benign
R4781:Tinag	UTSW	9	76996950	missense	possibly damaging	0.69
R5110:Tinag	UTSW	9	76952007	missense	probably damaging	1.00
R5328:Tinag	UTSW	9	77005631	nonsense	probably null
R5605:Tinag	UTSW	9	77045412	missense	probably damaging	1.00
R5897:Tinag	UTSW	9	77045444	missense	probably damaging	1.00
R6296:Tinag	UTSW	9	76996935	missense	possibly damaging	0.67
R6822:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R6915:Tinag	UTSW	9	77001615	missense	probably damaging	1.00
R7285:Tinag	UTSW	9	77045661	missense	probably benign
R7334:Tinag	UTSW	9	77001649	missense	probably damaging	1.00
R7974:Tinag	UTSW	9	76999849	missense	probably benign	0.01
R8354:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R8454:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R9029:Tinag	UTSW	9	77027014	splice site	probably benign
R9072:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9073:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
Z1177:Tinag	UTSW	9	77045498	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGGAACTTTAATGACATTTAGCC -3'
(R):5'- TCTTGCCAGTGAATCCGTG -3'

Sequencing Primer
(F):5'- GTCCTACGCACATAGCAA -3'
(R):5'- AATCCGTGCAGGGATATTAATGTG -3'

Posted On

2015-04-02