Incidental Mutation 'R3834:Olfr494'
ID275546
Institutional Source Beutler Lab
Gene Symbol Olfr494
Ensembl Gene ENSMUSG00000109631
Gene Nameolfactory receptor 494
SynonymsMOR204-10, GA_x6K02T2PBJ9-10697517-10698461
MMRRC Submission 040889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3834 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108365335-108368436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108368072 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 194 (D194V)
Ref Sequence ENSEMBL: ENSMUSP00000147830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000209743] [ENSMUST00000210291]
Predicted Effect probably damaging
Transcript: ENSMUST00000073059
AA Change: D194V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: D194V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209743
AA Change: D194V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210291
AA Change: D194V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.3623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh6a G A 3: 138,327,514 probably null Het
Bptf T C 11: 107,073,857 T1389A probably benign Het
Cfap54 A G 10: 92,801,123 probably benign Het
Coq5 G T 5: 115,284,576 G180W probably damaging Het
Cyp2d34 A G 15: 82,616,746 probably null Het
Cyp2j13 C T 4: 96,056,557 probably null Het
Fam114a1 C T 5: 65,006,073 T197I possibly damaging Het
Fbxo44 A G 4: 148,156,250 Y227H probably damaging Het
Gm5114 T A 7: 39,408,737 H486L possibly damaging Het
Grik4 T C 9: 42,629,123 R254G probably benign Het
Iqcm T C 8: 75,577,752 I47T possibly damaging Het
Kif20b A G 19: 34,935,028 Y278C probably damaging Het
Lbhd1 G A 19: 8,884,057 C43Y probably benign Het
Lrfn5 T A 12: 61,840,030 D201E probably damaging Het
Map1a G A 2: 121,307,322 G2635D probably damaging Het
Ms4a4a A T 19: 11,378,855 M35L probably benign Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Mug2 T C 6: 122,049,787 probably null Het
Nav2 T A 7: 49,545,858 I994N possibly damaging Het
Ngly1 T C 14: 16,290,766 probably benign Het
Nr1i2 T C 16: 38,253,929 probably null Het
Olfr561 A G 7: 102,775,286 Y254C probably damaging Het
Olfr651 T A 7: 104,553,345 V142D probably benign Het
Oxct2a C T 4: 123,322,473 V372I probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Pramef17 T A 4: 143,994,226 K48N probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Ptprc T A 1: 138,083,567 N584I probably damaging Het
Ptprt A G 2: 161,547,387 V1261A probably damaging Het
Rps20 A T 4: 3,834,610 I84N probably damaging Het
Scd3 A G 19: 44,241,717 Y313C probably damaging Het
Sertad2 T C 11: 20,648,482 I226T probably benign Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Slco1a1 G T 6: 141,943,437 Q50K possibly damaging Het
Stab2 A T 10: 86,949,912 I622N possibly damaging Het
Tmc4 C T 7: 3,672,007 V222M probably benign Het
Tmem145 T C 7: 25,311,361 F359L probably damaging Het
Tmem238 C A 7: 4,789,079 R155L possibly damaging Het
Vmn1r32 C A 6: 66,553,663 C43F probably benign Het
Vmn2r104 C T 17: 20,029,921 R696K probably benign Het
Other mutations in Olfr494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Olfr494 APN 7 108368318 missense probably damaging 1.00
IGL01934:Olfr494 APN 7 108368161 missense probably damaging 0.99
IGL02041:Olfr494 APN 7 108367535 missense probably damaging 1.00
IGL02253:Olfr494 APN 7 108368054 missense possibly damaging 0.80
IGL02902:Olfr494 APN 7 108368129 missense probably damaging 1.00
R0125:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R0523:Olfr494 UTSW 7 108368231 missense probably damaging 1.00
R0650:Olfr494 UTSW 7 108367789 missense probably damaging 1.00
R1268:Olfr494 UTSW 7 108367795 missense probably benign 0.06
R2036:Olfr494 UTSW 7 108367740 missense probably benign 0.00
R2162:Olfr494 UTSW 7 108367562 missense probably benign 0.08
R2278:Olfr494 UTSW 7 108368081 missense probably benign 0.01
R2368:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R3410:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3411:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R4322:Olfr494 UTSW 7 108368348 missense probably damaging 1.00
R4625:Olfr494 UTSW 7 108367688 missense probably damaging 0.98
R4724:Olfr494 UTSW 7 108367998 missense probably benign
R4843:Olfr494 UTSW 7 108368143 missense probably benign 0.01
R5525:Olfr494 UTSW 7 108367999 missense probably benign
R5954:Olfr494 UTSW 7 108367601 missense probably damaging 0.98
R7027:Olfr494 UTSW 7 108368350 missense probably damaging 0.98
R8041:Olfr494 UTSW 7 108367534 missense probably damaging 1.00
R8237:Olfr494 UTSW 7 108368027 missense probably damaging 1.00
Z1177:Olfr494 UTSW 7 108368261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCATGGCTTATGATCGC -3'
(R):5'- GGTGCCATAATAAAGAGTGACTGC -3'

Sequencing Primer
(F):5'- GCTTTGTAGCAATCTGCAACC -3'
(R):5'- CCATAATAAAGAGTGACTGCAGTGAG -3'
Posted On2015-04-06