Incidental Mutation 'R3851:Rrm2'
ID275933
Institutional Source Beutler Lab
Gene Symbol Rrm2
Ensembl Gene ENSMUSG00000020649
Gene Nameribonucleotide reductase M2
SynonymsR2
MMRRC Submission 040899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3851 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location24708241-24714146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24708599 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 47 (A47S)
Ref Sequence ENSEMBL: ENSMUSP00000020980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020980] [ENSMUST00000153058] [ENSMUST00000154588]
PDB Structure
SMALL SUBUNIT C-TERMINAL INHIBITORY PEPTIDE OF MOUSE RIBONUCLEOTIDE REDUCTASE AS BOUND TO THE LARGE SUBUNIT, NMR, 26 STRUCTURES [SOLUTION NMR]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER OXIDIZING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER REDUCING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER AND BOUND ACETATE. [X-RAY DIFFRACTION]
PROTEIN R2 OF RIBONUCLEOTIDE REDUCTASE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020980
AA Change: A47S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020980
Gene: ENSMUSG00000020649
AA Change: A47S

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 80 347 1.6e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147789
Predicted Effect probably benign
Transcript: ENSMUST00000153058
SMART Domains Protein: ENSMUSP00000120893
Gene: ENSMUSG00000020649

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ribonuc_red_sm 40 225 2.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154588
SMART Domains Protein: ENSMUSP00000119502
Gene: ENSMUSG00000020649

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 1 181 2.7e-88 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,390,165 W544* probably null Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Bcl9 G A 3: 97,209,653 P575L probably damaging Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Cry1 C A 10: 85,146,499 A328S probably benign Het
Dclre1a A T 19: 56,541,507 N799K probably damaging Het
Dnm3 A T 1: 162,321,127 probably null Het
Dock9 A T 14: 121,629,086 probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Drc7 C T 8: 95,061,836 Q276* probably null Het
Dzip3 T C 16: 48,950,013 T389A possibly damaging Het
Fam196a A G 7: 134,884,526 V432A probably benign Het
Flnc T A 6: 29,453,719 L1801Q probably damaging Het
Fmo9 A G 1: 166,663,367 L463P probably benign Het
Fnip2 G C 3: 79,462,157 H1074D probably damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
H2-Q5 T A 17: 35,394,139 M5K unknown Het
Il27ra C T 8: 84,040,688 E169K probably benign Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Lhfpl3 G A 5: 22,775,987 probably benign Het
Map4k3 A G 17: 80,644,323 probably benign Het
Mas1 C G 17: 12,841,993 S181T probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Nubpl T C 12: 52,144,027 M65T probably damaging Het
Olfr813 A C 10: 129,857,147 M210L probably benign Het
Parp14 A G 16: 35,853,748 I1042T possibly damaging Het
Pcdh15 C A 10: 74,631,686 S1779Y probably damaging Het
Pgm5 C T 19: 24,820,203 R205Q probably damaging Het
Radil T C 5: 142,506,997 D292G probably damaging Het
Rbp3 C A 14: 33,955,507 H471N probably damaging Het
Rgs14 T A 13: 55,379,614 L221Q possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Sult2b1 G T 7: 45,730,037 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Zfp521 T C 18: 13,717,751 probably benign Het
Other mutations in Rrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Rrm2 APN 12 24711439 splice site probably benign
IGL02361:Rrm2 APN 12 24711439 splice site probably benign
IGL02957:Rrm2 APN 12 24708441 missense probably damaging 0.99
R1804:Rrm2 UTSW 12 24708612 missense probably benign 0.42
R1854:Rrm2 UTSW 12 24713152 missense probably damaging 1.00
R3826:Rrm2 UTSW 12 24708599 missense probably benign
R3827:Rrm2 UTSW 12 24708599 missense probably benign
R3828:Rrm2 UTSW 12 24708599 missense probably benign
R3830:Rrm2 UTSW 12 24708599 missense probably benign
R3938:Rrm2 UTSW 12 24709432 missense probably damaging 1.00
R4042:Rrm2 UTSW 12 24711451 missense probably benign 0.00
R4192:Rrm2 UTSW 12 24708378 missense probably benign 0.04
R5274:Rrm2 UTSW 12 24710407 nonsense probably null
R8375:Rrm2 UTSW 12 24712752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCTGACAAGGAGAACAC -3'
(R):5'- TCGTGTGCTTAGCTGTCACG -3'

Sequencing Primer
(F):5'- AACACGGTGAGGGCGGC -3'
(R):5'- GACCCGAGTAGGACATTCTG -3'
Posted On2015-04-06