Incidental Mutation 'R3870:Xrcc6'
ID276541
Institutional Source Beutler Lab
Gene Symbol Xrcc6
Ensembl Gene ENSMUSG00000022471
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 6
SynonymsKu p70, G22p1, Ku70
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81987835-82040085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82025684 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 97 (S97T)
Ref Sequence ENSEMBL: ENSMUSP00000127927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069530] [ENSMUST00000100399] [ENSMUST00000164779] [ENSMUST00000165777] [ENSMUST00000168581] [ENSMUST00000170630] [ENSMUST00000230729]
Predicted Effect probably benign
Transcript: ENSMUST00000069530
AA Change: S255T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068559
Gene: ENSMUSG00000022471
AA Change: S255T

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 467 557 5e-34 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100399
AA Change: S255T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097968
Gene: ENSMUSG00000022471
AA Change: S255T

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 470 555 3.1e-31 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164775
Predicted Effect probably benign
Transcript: ENSMUST00000164779
AA Change: S97T

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127927
Gene: ENSMUSG00000022471
AA Change: S97T

DomainStartEndE-ValueType
Pfam:Ku_N 1 96 4.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164975
Predicted Effect probably benign
Transcript: ENSMUST00000165777
SMART Domains Protein: ENSMUSP00000131212
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Ku_N 35 106 7.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166311
Predicted Effect probably benign
Transcript: ENSMUST00000168581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170630
SMART Domains Protein: ENSMUSP00000126245
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Ku_N 35 205 1.2e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170907
Predicted Effect probably benign
Transcript: ENSMUST00000230729
Meta Mutation Damage Score 0.1688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuron apoptosis, decreased body size, abnormal B and T cell morphology, increased incidence of tumorigenesis, and increased cellular sensitivity to irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Xrcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Xrcc6 APN 15 82017200 critical splice donor site probably null
IGL01394:Xrcc6 APN 15 82025661 missense possibly damaging 0.69
IGL01648:Xrcc6 APN 15 82025634 missense probably damaging 0.96
R0312:Xrcc6 UTSW 15 82027222 splice site probably null
R0522:Xrcc6 UTSW 15 82022592 splice site probably benign
R1172:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1173:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1218:Xrcc6 UTSW 15 82022941 missense probably benign 0.00
R1269:Xrcc6 UTSW 15 82022847 missense possibly damaging 0.49
R1677:Xrcc6 UTSW 15 82029699 missense probably benign
R2049:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2140:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2142:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R3737:Xrcc6 UTSW 15 82029631 missense probably damaging 1.00
R3906:Xrcc6 UTSW 15 82029571 missense probably benign 0.01
R4197:Xrcc6 UTSW 15 82029224 missense probably benign 0.06
R4589:Xrcc6 UTSW 15 82022460 missense probably damaging 1.00
R4941:Xrcc6 UTSW 15 82039812 missense probably damaging 1.00
R5318:Xrcc6 UTSW 15 82037507 missense probably damaging 1.00
R5356:Xrcc6 UTSW 15 82029218 missense probably benign 0.00
R5576:Xrcc6 UTSW 15 82022492 missense probably damaging 1.00
R6157:Xrcc6 UTSW 15 82029104 intron probably null
R6596:Xrcc6 UTSW 15 82022954 start codon destroyed probably null 0.58
R6904:Xrcc6 UTSW 15 82029122 missense probably benign 0.19
R6970:Xrcc6 UTSW 15 82031174 missense probably benign 0.03
R7098:Xrcc6 UTSW 15 82035754 nonsense probably null
R7213:Xrcc6 UTSW 15 82016826 intron probably benign
X0063:Xrcc6 UTSW 15 82022493 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTCACACCAGGGATCTTCCTTG -3'
(R):5'- GTATCAAGGGATGCTCAGAGTAC -3'

Sequencing Primer
(F):5'- CTTGACTTGATGCATCTGAAGAAGCC -3'
(R):5'- ATGCTCAGAGTACTTAGCGC -3'
Posted On2015-04-06