Incidental Mutation 'R3870:Tlr12'
ID276491
Institutional Source Beutler Lab
Gene Symbol Tlr12
Ensembl Gene ENSMUSG00000062545
Gene Nametoll-like receptor 12
SynonymsLOC384059, Tlr11
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location128615443-128618619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128616568 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 630 (M630L)
Ref Sequence ENSEMBL: ENSMUSP00000074381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074829]
Predicted Effect probably benign
Transcript: ENSMUST00000074829
AA Change: M630L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074381
Gene: ENSMUSG00000062545
AA Change: M630L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
LRR 291 314 1.67e2 SMART
LRR 315 338 9.24e1 SMART
LRR_TYP 341 364 2.79e-4 SMART
LRR 365 388 4.34e-1 SMART
LRR 389 412 1.37e1 SMART
LRR 413 436 1.71e2 SMART
low complexity region 443 459 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
LRR 591 614 5.56e0 SMART
Pfam:TIR 760 905 5.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133382
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit a greatly increased susceptibility to kidney infection by uropathogenic bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Tlr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tlr12 APN 4 128617422 missense probably benign 0.00
IGL00654:Tlr12 APN 4 128617440 missense probably benign 0.27
IGL01290:Tlr12 APN 4 128617837 missense probably damaging 1.00
IGL01406:Tlr12 APN 4 128616339 nonsense probably null
IGL01550:Tlr12 APN 4 128615742 missense probably damaging 1.00
IGL02590:Tlr12 APN 4 128617389 missense probably benign 0.00
IGL02592:Tlr12 APN 4 128617686 missense probably benign 0.02
IGL02635:Tlr12 APN 4 128616816 missense probably damaging 0.98
IGL02714:Tlr12 APN 4 128617713 missense probably damaging 1.00
IGL03104:Tlr12 APN 4 128615892 missense probably benign 0.01
IGL03131:Tlr12 APN 4 128615877 missense probably damaging 1.00
IGL03329:Tlr12 APN 4 128616852 missense possibly damaging 0.84
IGL03354:Tlr12 APN 4 128615937 missense probably damaging 1.00
R0848:Tlr12 UTSW 4 128616291 missense probably benign 0.05
R1536:Tlr12 UTSW 4 128617752 missense possibly damaging 0.95
R1807:Tlr12 UTSW 4 128617436 missense probably benign 0.21
R1989:Tlr12 UTSW 4 128617069 missense probably benign 0.04
R2905:Tlr12 UTSW 4 128616009 missense probably damaging 1.00
R4026:Tlr12 UTSW 4 128616508 missense probably benign 0.00
R4296:Tlr12 UTSW 4 128617788 missense probably damaging 1.00
R4398:Tlr12 UTSW 4 128616195 missense probably benign 0.09
R4528:Tlr12 UTSW 4 128618025 missense probably damaging 1.00
R4559:Tlr12 UTSW 4 128615770 missense probably damaging 1.00
R4599:Tlr12 UTSW 4 128617332 missense probably benign 0.06
R4999:Tlr12 UTSW 4 128617680 missense probably benign 0.38
R5054:Tlr12 UTSW 4 128617270 nonsense probably null
R5177:Tlr12 UTSW 4 128618376 missense probably damaging 0.96
R5207:Tlr12 UTSW 4 128616709 nonsense probably null
R5533:Tlr12 UTSW 4 128615863 missense probably damaging 0.99
R6484:Tlr12 UTSW 4 128616054 missense probably damaging 1.00
R6568:Tlr12 UTSW 4 128617992 missense probably benign 0.10
R6821:Tlr12 UTSW 4 128616892 missense possibly damaging 0.95
R7465:Tlr12 UTSW 4 128616170 missense probably damaging 1.00
R7594:Tlr12 UTSW 4 128617680 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGAGTTTCAGCTCCAACGTCTG -3'
(R):5'- GCTTCAGTCCATAACCCAGC -3'

Sequencing Primer
(F):5'- GCAGAGAGCCTGTCTTGTC -3'
(R):5'- ATAACCCAGCCCCGTTCGG -3'
Posted On2015-04-06