Mutagenetix > Incidental Mutations

Incidental Mutation 'R3904:Amt'

309104

Institutional Source

Beutler Lab

Gene Symbol

Amt

Ensembl Gene

ENSMUSG00000032607

Gene Name

aminomethyltransferase

Synonyms

EG434437

MMRRC Submission

040812-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108296853-108302302 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108297221 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 62 (R62C)

Ref Sequence

ENSEMBL: ENSMUSP00000035230 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035227] [ENSMUST00000035230]

Predicted Effect

probably benign
Transcript: ENSMUST00000035227

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035230
AA Change: R62C

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000035230
Gene: ENSMUSG00000032607
AA Change: R62C

Domain	Start	End	E-Value	Type
Pfam:GCV_T	38	291	7.8e-86	PFAM
Pfam:GCV_T_C	300	392	1.6e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194496

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195695

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of four critical components of the glycine cleavage system. Mutations in this gene have been associated with glycine encephalopathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele develop neural tubes defects at high frequency and exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	C	3: 138,066,639	I530L	probably benign	Het
5930422O12Rik	T	C	8: 33,429,439	S96P	probably damaging	Het
Acot4	A	G	12: 84,043,327		probably null	Het
Alms1	A	G	6: 85,621,678	D1631G	probably benign	Het
Amd1	C	T	10: 40,290,457	R210H	probably benign	Het
Anapc1	A	G	2: 128,642,519	F1175S	probably damaging	Het
Ano4	A	G	10: 89,025,005	F337S	probably damaging	Het
Bub1	A	C	2: 127,821,942	I207S	probably benign	Het
Cfap53	T	A	18: 74,307,374	L405M	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col6a1	C	T	10: 76,711,341	R730H	unknown	Het
Esp3	A	T	17: 40,635,929	T48S	possibly damaging	Het
Fam35a	A	G	14: 34,259,709	W491R	probably damaging	Het
Fmo1	G	T	1: 162,833,768	N315K	possibly damaging	Het
Gm595	T	C	X: 48,841,544	N649S	possibly damaging	Het
Impg1	A	G	9: 80,345,585	S438P	possibly damaging	Het
Jsrp1	T	A	10: 80,812,412	M1L	probably benign	Het
Klra14-ps	T	A	6: 130,152,549		noncoding transcript	Het
Mrm3	A	G	11: 76,244,286	M108V	probably benign	Het
Mtf2	T	A	5: 108,081,000	F61I	probably damaging	Het
Nat10	A	T	2: 103,726,247		probably benign	Het
Olfr1356	T	G	10: 78,847,298	I206L	probably benign	Het
Olfr1380	T	C	11: 49,564,758	I279T	possibly damaging	Het
Pcgf5	T	C	19: 36,440,095	I140T	probably damaging	Het
Pfpl	T	C	19: 12,430,437	L684P	probably benign	Het
Psmd10	T	C	X: 140,949,303	*152W	probably null	Het
Ptpn23	A	C	9: 110,389,245	M600R	probably benign	Het
Pxmp4	C	T	2: 154,588,049	R140H	probably damaging	Het
Rnf112	T	C	11: 61,450,385	E410G	probably damaging	Het
Samd9l	T	A	6: 3,376,830	K144*	probably null	Het
Slc46a3	C	T	5: 147,886,454	E193K	probably benign	Het
Snap23	A	C	2: 120,599,334	D209A	possibly damaging	Het
Tg	C	T	15: 66,766,162	Q656*	probably null	Het
Tshz2	A	G	2: 169,884,387	Y301C	probably damaging	Het
Ttn	T	A	2: 76,840,294		probably benign	Het
Unc80	C	T	1: 66,639,296	Q2011*	probably null	Het
Vwa3a	A	G	7: 120,758,876	T57A	probably benign	Het
Zfp518a	C	T	19: 40,914,920	Q1098*	probably null	Het

Other mutations in Amt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02657:Amt	APN	9	108301380	missense	probably damaging	1.00
IGL03277:Amt	APN	9	108301219	missense	probably benign
R1333:Amt	UTSW	9	108301097	missense	probably benign	0.04
R1856:Amt	UTSW	9	108297162	missense	probably damaging	1.00
R3843:Amt	UTSW	9	108297221	missense	possibly damaging	0.74
R3844:Amt	UTSW	9	108297221	missense	possibly damaging	0.74
R3903:Amt	UTSW	9	108297221	missense	possibly damaging	0.74
R4729:Amt	UTSW	9	108300652	missense	probably damaging	1.00
R4814:Amt	UTSW	9	108299780	missense	probably benign
R5149:Amt	UTSW	9	108301451	missense	possibly damaging	0.59
R6000:Amt	UTSW	9	108301485	missense	probably benign	0.20
R6044:Amt	UTSW	9	108297251	missense	probably damaging	1.00
R6911:Amt	UTSW	9	108301229	critical splice donor site	probably null
R6957:Amt	UTSW	9	108299833	missense	possibly damaging	0.51
R7618:Amt	UTSW	9	108299878	missense	probably damaging	1.00
R7658:Amt	UTSW	9	108297231	missense	probably damaging	0.98
R7783:Amt	UTSW	9	108297215	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCACTCAGTTCTGTACAGG -3'
(R):5'- TCCTGAGTTAGCCCTCTAGAGTC -3'

Sequencing Primer
(F):5'- CTCAGTTCTGTACAGGTGGGATAAAG -3'
(R):5'- GAGTTAGCCCTCTAGAGTCCCTAAC -3'

Posted On

2015-04-17