Incidental Mutation 'R3913:Olfr1022'
ID309491
Institutional Source Beutler Lab
Gene Symbol Olfr1022
Ensembl Gene ENSMUSG00000057761
Gene Nameolfactory receptor 1022
SynonymsGA_x6K02T2Q125-47347069-47348016, MOR196-1
MMRRC Submission 040911-MU
Accession Numbers

Ncbi RefSeq: NM_146589.2; MGI: 3030856

Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85868594-85869541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85868771 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 60 (Y60H)
Ref Sequence ENSEMBL: ENSMUSP00000059312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054736] [ENSMUST00000121914]
Predicted Effect probably damaging
Transcript: ENSMUST00000054736
AA Change: Y60H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059312
Gene: ENSMUSG00000057761
AA Change: Y60H

DomainStartEndE-ValueType
Pfam:7tm_4 31 312 4.8e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 304 8e-6 PFAM
Pfam:7tm_1 41 290 9.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121914
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Olfr1022
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02701:Olfr1022 APN 2 85869458 missense probably benign 0.22
IGL03265:Olfr1022 APN 2 85869150 missense possibly damaging 0.80
PIT4366001:Olfr1022 UTSW 2 85868882 missense probably damaging 1.00
R0057:Olfr1022 UTSW 2 85869253 nonsense probably null
R0057:Olfr1022 UTSW 2 85869253 nonsense probably null
R0554:Olfr1022 UTSW 2 85869519 missense probably benign 0.00
R3873:Olfr1022 UTSW 2 85868962 nonsense probably null
R4698:Olfr1022 UTSW 2 85869252 missense possibly damaging 0.90
R5628:Olfr1022 UTSW 2 85868805 missense probably damaging 0.99
R6467:Olfr1022 UTSW 2 85869370 nonsense probably null
R6947:Olfr1022 UTSW 2 85868927 missense probably benign 0.01
R7092:Olfr1022 UTSW 2 85868607 missense probably damaging 1.00
R7351:Olfr1022 UTSW 2 85864071 unclassified probably benign
R7574:Olfr1022 UTSW 2 85869006 missense probably benign 0.03
R8430:Olfr1022 UTSW 2 85869182 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAGGTCACTGCTTACATTTCTTG -3'
(R):5'- TCTAGTGCCATTGAAGCAAGG -3'

Sequencing Primer
(F):5'- GTCACTTTCAGCTTGCAAGG -3'
(R):5'- AGGAGATAAAACTCAGTGATCACC -3'
Posted On2015-04-17