Incidental Mutation 'R3891:Pcdhb16'
ID310417
Institutional Source Beutler Lab
Gene Symbol Pcdhb16
Ensembl Gene ENSMUSG00000047910
Gene Nameprotocadherin beta 16
SynonymsPcdhb8, PcdhbP
MMRRC Submission 040803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3891 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37477814-37483038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37479369 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 461 (I461F)
Ref Sequence ENSEMBL: ENSMUSP00000056347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000050034
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
AA Change: I461F

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910
AA Change: I461F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,762,054 T72A probably damaging Het
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
C1qb A T 4: 136,880,416 V212E probably damaging Het
Cfap54 T A 10: 93,038,846 I563F possibly damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Clrn3 T C 7: 135,518,465 T131A possibly damaging Het
Col9a1 T C 1: 24,185,436 probably null Het
Def8 T C 8: 123,458,344 probably benign Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dscaml1 A T 9: 45,717,484 D1112V possibly damaging Het
Ehbp1l1 A G 19: 5,718,312 S988P possibly damaging Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Gm10088 T C 16: 19,028,251 noncoding transcript Het
Gm4907 A G X: 23,906,941 Y227C probably damaging Het
Gm5616 A G 9: 48,450,509 noncoding transcript Het
H2-T24 T A 17: 36,015,438 I190F possibly damaging Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Il1rap A G 16: 26,676,856 Y71C probably damaging Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lsamp T C 16: 39,984,692 V11A probably benign Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Naip2 T A 13: 100,161,098 E810V probably damaging Het
Nfe2l1 A G 11: 96,819,997 S181P possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr170 A G 16: 19,606,455 I71T probably damaging Het
Olfr31 T A 14: 14,328,114 M1K probably null Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Pex2 C T 3: 5,560,948 C267Y probably damaging Het
Pgghg T C 7: 140,945,703 I473T probably damaging Het
Polr2e G T 10: 80,037,379 P80T probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rpl13 A G 8: 123,105,168 E201G probably damaging Het
Skint2 A G 4: 112,624,186 E82G probably damaging Het
Skor2 A G 18: 76,858,655 D24G unknown Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc29a3 T A 10: 60,716,261 K335* probably null Het
Slc30a6 T A 17: 74,419,546 D282E probably benign Het
Slc9a7 A G X: 20,186,113 F247S probably damaging Het
Slx4 A T 16: 3,979,909 I1537N probably damaging Het
Specc1 C T 11: 62,151,913 T872M probably benign Het
Stard10 G A 7: 101,343,930 R231Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Vwa1 T C 4: 155,773,194 E49G probably damaging Het
Zc3h12a A G 4: 125,126,885 F55S probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Pcdhb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pcdhb16 APN 18 37478570 missense possibly damaging 0.95
IGL00540:Pcdhb16 APN 18 37479798 missense probably damaging 1.00
IGL01380:Pcdhb16 APN 18 37479445 missense probably benign 0.30
IGL02043:Pcdhb16 APN 18 37479195 missense probably benign 0.05
IGL02103:Pcdhb16 APN 18 37480108 missense probably benign 0.19
IGL02151:Pcdhb16 APN 18 37478358 missense possibly damaging 0.80
IGL02619:Pcdhb16 APN 18 37478217 nonsense probably null
IGL02832:Pcdhb16 APN 18 37478474 missense probably damaging 1.00
IGL03190:Pcdhb16 APN 18 37479343 missense probably damaging 1.00
IGL03274:Pcdhb16 APN 18 37479232 missense probably benign 0.04
IGL03292:Pcdhb16 APN 18 37480384 missense probably damaging 0.99
R0076:Pcdhb16 UTSW 18 37478359 missense probably damaging 1.00
R0423:Pcdhb16 UTSW 18 37480369 missense probably benign 0.00
R1191:Pcdhb16 UTSW 18 37479873 missense probably damaging 1.00
R1254:Pcdhb16 UTSW 18 37479295 missense possibly damaging 0.67
R1417:Pcdhb16 UTSW 18 37478127 missense probably benign 0.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1517:Pcdhb16 UTSW 18 37478098 missense probably benign 0.03
R1645:Pcdhb16 UTSW 18 37479370 missense probably benign 0.05
R1706:Pcdhb16 UTSW 18 37479652 missense probably benign 0.26
R1770:Pcdhb16 UTSW 18 37479180 missense probably damaging 1.00
R1809:Pcdhb16 UTSW 18 37478388 missense probably damaging 0.99
R1946:Pcdhb16 UTSW 18 37478899 nonsense probably null
R1967:Pcdhb16 UTSW 18 37479662 missense probably damaging 1.00
R2008:Pcdhb16 UTSW 18 37478263 missense probably damaging 1.00
R2220:Pcdhb16 UTSW 18 37478967 missense probably benign 0.16
R2432:Pcdhb16 UTSW 18 37479930 missense probably damaging 0.98
R3121:Pcdhb16 UTSW 18 37478218 missense possibly damaging 0.55
R3692:Pcdhb16 UTSW 18 37478287 missense probably benign 0.28
R3766:Pcdhb16 UTSW 18 37478196 nonsense probably null
R3892:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R4551:Pcdhb16 UTSW 18 37479834 missense probably damaging 1.00
R4614:Pcdhb16 UTSW 18 37480345 missense probably benign 0.22
R4716:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R4908:Pcdhb16 UTSW 18 37479841 unclassified probably null
R5185:Pcdhb16 UTSW 18 37480089 missense possibly damaging 0.96
R5225:Pcdhb16 UTSW 18 37479958 missense probably benign 0.02
R5422:Pcdhb16 UTSW 18 37479867 missense probably damaging 1.00
R5939:Pcdhb16 UTSW 18 37478064 missense probably benign
R6149:Pcdhb16 UTSW 18 37479155 missense possibly damaging 0.95
R6647:Pcdhb16 UTSW 18 37479172 missense possibly damaging 0.57
R7080:Pcdhb16 UTSW 18 37478463 nonsense probably null
R7354:Pcdhb16 UTSW 18 37478124 missense possibly damaging 0.79
R7413:Pcdhb16 UTSW 18 37478922 nonsense probably null
R7459:Pcdhb16 UTSW 18 37479553 missense probably benign 0.26
R7655:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7656:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7827:Pcdhb16 UTSW 18 37478851 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGGGGAAAACTTTTATACGCTG -3'
(R):5'- TGGAATTCAAAGGCCTGCAG -3'

Sequencing Primer
(F):5'- GCTGTTATCACAAAAACCACTGG -3'
(R):5'- TCATAGTCCAGTGCCCTGAG -3'
Posted On2015-04-17