Incidental Mutation 'R4017:Cpeb4'
ID311994
Institutional Source Beutler Lab
Gene Symbol Cpeb4
Ensembl Gene ENSMUSG00000020300
Gene Namecytoplasmic polyadenylation element binding protein 4
Synonyms
MMRRC Submission 041611-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R4017 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location31872211-31935634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31924671 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 484 (D484G)
Ref Sequence ENSEMBL: ENSMUSP00000105039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020543] [ENSMUST00000109412] [ENSMUST00000155278]
Predicted Effect probably damaging
Transcript: ENSMUST00000020543
AA Change: D501G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020543
Gene: ENSMUSG00000020300
AA Change: D501G

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 83 96 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 281 314 N/A INTRINSIC
RRM 473 545 4.3e-5 SMART
RRM 581 654 1.11e-2 SMART
PDB:2M13|A 655 720 3e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000109412
AA Change: D484G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105039
Gene: ENSMUSG00000020300
AA Change: D484G

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 83 96 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 281 314 N/A INTRINSIC
RRM 456 528 4.3e-5 SMART
RRM 564 637 1.11e-2 SMART
PDB:2M13|A 638 703 3e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000155278
AA Change: D164G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116753
Gene: ENSMUSG00000020300
AA Change: D164G

DomainStartEndE-ValueType
RRM 136 208 4.3e-5 SMART
RRM 244 317 1.11e-2 SMART
PDB:2M13|A 318 383 2e-7 PDB
Meta Mutation Damage Score 0.9292 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show slightly longer dendritic spines but normal hippocampal synaptic plasticity and memory. Homozygotes for a different null allele show neo- and postnatal lethality, erythropoiesis, suckling and mobility defects, and reduced motor axon branching and NMJ formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 G T 19: 4,867,546 T423N possibly damaging Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arhgap21 G T 2: 20,892,104 F121L probably benign Het
BC004004 T C 17: 29,298,732 S307P probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dnm2 A G 9: 21,494,604 Y553C probably damaging Het
Dync1h1 G T 12: 110,643,190 R2802I probably damaging Het
Eif2a T A 3: 58,545,355 M209K probably damaging Het
Epb41 A T 4: 131,982,445 probably benign Het
Fnip1 A G 11: 54,509,987 K1071E probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Klhl10 G A 11: 100,445,674 M162I probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Npr1 T C 3: 90,456,232 E828G probably damaging Het
Obscn A G 11: 59,132,622 F643S probably damaging Het
Olfr1112 A G 2: 87,192,502 S272G probably benign Het
Olfr748 A T 14: 50,710,876 D182V probably benign Het
Pcdhga8 T C 18: 37,815,738 V69A probably damaging Het
Ppp6r1 C A 7: 4,633,744 C688F probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf157 A T 11: 116,359,241 probably null Het
Saxo1 A T 4: 86,557,996 I7N possibly damaging Het
Scn7a A T 2: 66,741,985 I214N probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Suz12 G T 11: 80,013,466 V211F probably damaging Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp940 T C 7: 29,845,934 I183V probably benign Het
Other mutations in Cpeb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Cpeb4 APN 11 31873204 missense probably damaging 1.00
IGL02329:Cpeb4 APN 11 31872316 missense possibly damaging 0.94
IGL02396:Cpeb4 APN 11 31925441 missense probably benign 0.38
IGL03304:Cpeb4 APN 11 31872739 missense probably damaging 1.00
FR4304:Cpeb4 UTSW 11 31927638 critical splice acceptor site probably benign
FR4342:Cpeb4 UTSW 11 31927638 critical splice acceptor site probably benign
R1174:Cpeb4 UTSW 11 31920472 missense probably damaging 0.96
R3969:Cpeb4 UTSW 11 31872811 missense possibly damaging 0.95
R4005:Cpeb4 UTSW 11 31925390 missense probably damaging 0.96
R4539:Cpeb4 UTSW 11 31873206 missense probably damaging 1.00
R4580:Cpeb4 UTSW 11 31927757 critical splice donor site probably null
R4978:Cpeb4 UTSW 11 31931509 missense probably null 0.88
R5632:Cpeb4 UTSW 11 31889877 missense probably damaging 1.00
R5809:Cpeb4 UTSW 11 31872801 missense probably damaging 1.00
R6164:Cpeb4 UTSW 11 31920584 critical splice donor site probably null
R6735:Cpeb4 UTSW 11 31924700 missense probably benign 0.19
R6955:Cpeb4 UTSW 11 31908864 missense possibly damaging 0.90
R7312:Cpeb4 UTSW 11 31931417 missense probably damaging 0.98
R7341:Cpeb4 UTSW 11 31918807 missense possibly damaging 0.86
R7382:Cpeb4 UTSW 11 31872828 missense probably damaging 0.97
R7705:Cpeb4 UTSW 11 31872327 missense probably damaging 0.97
RF004:Cpeb4 UTSW 11 31927634 critical splice acceptor site probably benign
RF019:Cpeb4 UTSW 11 31927634 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GGCACATACTTGTTTGAGTGTC -3'
(R):5'- GGTAGCATCTGGAAACATCTTGTG -3'

Sequencing Primer
(F):5'- GTGTCCACATTATTCTAGCTACAGG -3'
(R):5'- ACGCTCCAAATTAGACAATC -3'
Posted On2015-04-29