Incidental Mutation 'R4051:Ldlrad3'
ID314145
Institutional Source Beutler Lab
Gene Symbol Ldlrad3
Ensembl Gene ENSMUSG00000048058
Gene Namelow density lipoprotein receptor class A domain containing 3
SynonymsLrad3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101950203-102186385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101953162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 240 (D240N)
Ref Sequence ENSEMBL: ENSMUSP00000106853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058790] [ENSMUST00000111222]
Predicted Effect probably damaging
Transcript: ENSMUST00000058790
AA Change: D272N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054134
Gene: ENSMUSG00000048058
AA Change: D272N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LDLa 28 66 5.18e-12 SMART
LDLa 70 108 2.82e-13 SMART
LDLa 112 149 1.26e-10 SMART
transmembrane domain 172 194 N/A INTRINSIC
low complexity region 295 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111222
AA Change: D240N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106853
Gene: ENSMUSG00000048058
AA Change: D240N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LDLa 38 76 2.82e-13 SMART
LDLa 80 117 1.26e-10 SMART
transmembrane domain 140 162 N/A INTRINSIC
low complexity region 263 286 N/A INTRINSIC
Meta Mutation Damage Score 0.1294 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Chtf18 A G 17: 25,719,194 V955A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Disc1 A G 8: 125,148,425 T547A possibly damaging Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Fli1 T G 9: 32,452,162 D176A probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Zfp217 T C 2: 170,112,616 probably null Het
Other mutations in Ldlrad3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03210:Ldlrad3 APN 2 102069926 splice site probably benign
R4052:Ldlrad3 UTSW 2 101953162 missense probably damaging 1.00
R4208:Ldlrad3 UTSW 2 101953162 missense probably damaging 1.00
R4709:Ldlrad3 UTSW 2 102069998 missense probably damaging 1.00
R4887:Ldlrad3 UTSW 2 102113536 missense probably damaging 1.00
R4894:Ldlrad3 UTSW 2 102057948 missense probably damaging 1.00
R4924:Ldlrad3 UTSW 2 102069983 missense possibly damaging 0.91
R5084:Ldlrad3 UTSW 2 102069984 missense probably damaging 1.00
R5224:Ldlrad3 UTSW 2 102113609 missense probably damaging 0.96
R5631:Ldlrad3 UTSW 2 102069956 missense probably damaging 1.00
R6714:Ldlrad3 UTSW 2 101952952 missense probably benign
R6803:Ldlrad3 UTSW 2 102113547 missense possibly damaging 0.89
R7200:Ldlrad3 UTSW 2 102113558 missense probably damaging 0.98
R7200:Ldlrad3 UTSW 2 102113560 missense probably damaging 0.98
R7340:Ldlrad3 UTSW 2 102066839 intron probably null
R7456:Ldlrad3 UTSW 2 101954925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATGGACTTTGGAATCGCTG -3'
(R):5'- TCTCAGAACTGCCGTTGTTC -3'

Sequencing Primer
(F):5'- AGTCTCTGGGCTCAGCAGAG -3'
(R):5'- AACTGCCGTTGTTCTTGGC -3'
Posted On2015-04-30