Incidental Mutation 'R4066:Togaram2'
ID316134
Institutional Source Beutler Lab
Gene Symbol Togaram2
Ensembl Gene ENSMUSG00000045761
Gene NameTOG array regulator of axonemal microtubules 2
SynonymsFam179a, 4632412N22Rik
MMRRC Submission 040973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4066 (G1)
Quality Score186
Status Validated
Chromosome17
Chromosomal Location71673261-71729669 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 71716238 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097284] [ENSMUST00000144479] [ENSMUST00000153445]
Predicted Effect probably benign
Transcript: ENSMUST00000097284
SMART Domains Protein: ENSMUSP00000094886
Gene: ENSMUSG00000045761

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129072
Predicted Effect probably benign
Transcript: ENSMUST00000144479
SMART Domains Protein: ENSMUSP00000114359
Gene: ENSMUSG00000045761

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Pfam:CLASP_N 493 706 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153445
SMART Domains Protein: ENSMUSP00000122691
Gene: ENSMUSG00000045761

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161407
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A T 1: 63,563,425 H582L probably damaging Het
Ankrd13d C T 19: 4,270,360 A118T probably benign Het
Arhgap30 C T 1: 171,408,323 T755I probably benign Het
Cab39l A G 14: 59,547,005 H285R probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Dspp T A 5: 104,177,194 N474K unknown Het
Fanci T C 7: 79,412,757 probably null Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Gm8220 A T 14: 44,285,638 R12* probably null Het
Gm9825 T A 6: 7,983,009 noncoding transcript Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Hnrnpr C A 4: 136,339,346 probably benign Het
Htt C T 5: 34,878,847 T2046I probably benign Het
Kat7 T C 11: 95,284,141 D259G possibly damaging Het
Klra9 T C 6: 130,188,744 T103A probably benign Het
Lad1 A G 1: 135,827,427 E147G probably damaging Het
Lipo2 T C 19: 33,720,859 I373V probably benign Het
Ltb4r1 G T 14: 55,767,495 W85L probably damaging Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Myl10 A G 5: 136,695,450 K70E probably damaging Het
Nptx2 G T 5: 144,556,312 W403L probably damaging Het
Nyap2 A G 1: 81,241,835 Y524C probably damaging Het
Olfr1245 T A 2: 89,575,179 L182F probably damaging Het
Olfr1415 A G 1: 92,491,189 C189R probably damaging Het
Olfr906 T A 9: 38,488,482 M151K probably benign Het
Pde9a A G 17: 31,443,838 *64W probably null Het
Ppp2r5b T C 19: 6,229,330 Y379C probably damaging Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Recql4 A G 15: 76,705,827 Y673H probably damaging Het
Shcbp1 A G 8: 4,748,716 I401T probably damaging Het
Shd A T 17: 55,971,581 D48V probably damaging Het
Slc14a1 A G 18: 78,111,377 W209R probably damaging Het
Slc2a9 T C 5: 38,483,349 K6E probably benign Het
Slco6d1 A G 1: 98,463,846 probably benign Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stau2 A G 1: 16,394,059 S156P possibly damaging Het
Stmn2 T C 3: 8,509,608 probably benign Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Xpo4 G T 14: 57,588,054 H939N probably benign Het
Other mutations in Togaram2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Togaram2 APN 17 71725004 missense probably damaging 1.00
IGL01298:Togaram2 APN 17 71716513 missense possibly damaging 0.71
IGL01625:Togaram2 APN 17 71714698 missense probably benign 0.06
IGL01691:Togaram2 APN 17 71729490 missense probably null 0.02
IGL02165:Togaram2 APN 17 71697866 missense probably benign 0.00
IGL02186:Togaram2 APN 17 71685171 missense possibly damaging 0.64
IGL02664:Togaram2 APN 17 71729239 missense probably damaging 0.97
IGL02712:Togaram2 APN 17 71704754 missense probably benign 0.04
IGL03000:Togaram2 APN 17 71717370 missense probably benign 0.08
IGL03209:Togaram2 APN 17 71695745 critical splice donor site probably null
R0211:Togaram2 UTSW 17 71729248 missense probably damaging 1.00
R0212:Togaram2 UTSW 17 71724983 missense probably damaging 1.00
R0219:Togaram2 UTSW 17 71714230 splice site probably benign
R0268:Togaram2 UTSW 17 71697998 critical splice donor site probably null
R0617:Togaram2 UTSW 17 71700509 missense possibly damaging 0.87
R0831:Togaram2 UTSW 17 71716444 missense probably damaging 1.00
R0972:Togaram2 UTSW 17 71707314 missense probably damaging 1.00
R1635:Togaram2 UTSW 17 71697851 missense probably benign 0.05
R1799:Togaram2 UTSW 17 71691455 missense probably damaging 1.00
R2062:Togaram2 UTSW 17 71716365 missense probably benign 0.26
R2414:Togaram2 UTSW 17 71716309 intron probably benign
R2866:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R4807:Togaram2 UTSW 17 71697923 missense probably damaging 1.00
R5659:Togaram2 UTSW 17 71687672 missense probably damaging 0.96
R5680:Togaram2 UTSW 17 71689209 missense probably benign 0.00
R5975:Togaram2 UTSW 17 71729205 missense probably damaging 1.00
R5996:Togaram2 UTSW 17 71704783 missense probably damaging 0.99
R6619:Togaram2 UTSW 17 71689271 missense probably damaging 0.99
R6682:Togaram2 UTSW 17 71704754 missense probably benign 0.04
R6922:Togaram2 UTSW 17 71707134 missense probably damaging 1.00
R6956:Togaram2 UTSW 17 71729188 missense probably benign 0.00
R6968:Togaram2 UTSW 17 71709613 missense probably damaging 1.00
R7007:Togaram2 UTSW 17 71709643 missense probably damaging 0.99
R7015:Togaram2 UTSW 17 71709568 missense possibly damaging 0.62
R7140:Togaram2 UTSW 17 71714766 missense probably benign 0.00
R7383:Togaram2 UTSW 17 71700517 missense probably damaging 1.00
R7691:Togaram2 UTSW 17 71716410 missense probably benign 0.16
R7778:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7824:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7862:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7864:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
R7945:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7947:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
X0063:Togaram2 UTSW 17 71707197 missense possibly damaging 0.91
Z1088:Togaram2 UTSW 17 71714280 missense possibly damaging 0.87
Z1177:Togaram2 UTSW 17 71701002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTTACACATCCTCAGAAAAGGG -3'
(R):5'- TACTCAAGGAGCTTCCCAACG -3'

Sequencing Primer
(F):5'- TTACACATCCTCAGAAAAGGGAAATG -3'
(R):5'- ATCCGAGCCTGGAACTCCTTG -3'
Posted On2015-05-15