Incidental Mutation 'R4247:Grasp'
ID320481
Institutional Source Beutler Lab
Gene Symbol Grasp
Ensembl Gene ENSMUSG00000000531
Gene NameGRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Synonymstamalin
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R4247 (G1)
Quality Score186
Status Validated
Chromosome15
Chromosomal Location101224188-101232756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101224537 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 79 (R79L)
Ref Sequence ENSEMBL: ENSMUSP00000000543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000543
AA Change: R79L

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000543
Gene: ENSMUSG00000000531
AA Change: R79L

DomainStartEndE-ValueType
low complexity region 30 57 N/A INTRINSIC
PDZ 109 189 2.12e-13 SMART
low complexity region 248 277 N/A INTRINSIC
low complexity region 291 312 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229610
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a molecular scaffold, linking receptors, including group 1 metabotropic glutamate receptors, to neuronal proteins. The encoded protein contains conserved domains, including a leucine zipper sequence, PDZ domain and a C-terminal PDZ-binding motif. Alternately spliced transcript variants have been observed for this gene.[provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted null mutations develop and behave normally under ordinary conditions but display a marked reduction in sensitivity to acute morphine responses and impaired adaptive responses to morphine and cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Grasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Grasp APN 15 101228896 splice site probably benign
IGL02069:Grasp APN 15 101224465 missense probably damaging 1.00
IGL02516:Grasp APN 15 101229051 missense probably damaging 1.00
IGL02997:Grasp APN 15 101231018 missense probably damaging 1.00
IGL03079:Grasp APN 15 101230567 missense probably damaging 1.00
R0020:Grasp UTSW 15 101230552 missense probably damaging 1.00
R0020:Grasp UTSW 15 101230552 missense probably damaging 1.00
R1916:Grasp UTSW 15 101226969 splice site probably benign
R1952:Grasp UTSW 15 101224500 missense probably benign 0.07
R5040:Grasp UTSW 15 101229042 missense probably damaging 1.00
R5117:Grasp UTSW 15 101230537 missense probably damaging 1.00
R7290:Grasp UTSW 15 101231538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGCAAGGCTACACGCGG -3'
(R):5'- CCAGATGGAGCAAGCTGTAG -3'

Sequencing Primer
(F):5'- GACTCAGGAAGCTGCAGC -3'
(R):5'- TACAGCCTTCTGAGACCCGAG -3'
Posted On2015-06-12