Incidental Mutation 'R4247:Hsdl2'
ID320453
Institutional Source Beutler Lab
Gene Symbol Hsdl2
Ensembl Gene ENSMUSG00000028383
Gene Namehydroxysteroid dehydrogenase like 2
Synonyms2610207I16Rik
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59581563-59618689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59594417 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 16 (N16I)
Ref Sequence ENSEMBL: ENSMUSP00000119139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030078] [ENSMUST00000107528] [ENSMUST00000128792]
Predicted Effect unknown
Transcript: ENSMUST00000030078
AA Change: N101I
SMART Domains Protein: ENSMUSP00000030078
Gene: ENSMUSG00000028383
AA Change: N101I

DomainStartEndE-ValueType
Pfam:KR 11 142 6.3e-7 PFAM
Pfam:adh_short 11 209 2.9e-37 PFAM
Pfam:adh_short_C2 17 217 3.3e-11 PFAM
low complexity region 295 367 N/A INTRINSIC
Pfam:SCP2 382 484 4.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107528
SMART Domains Protein: ENSMUSP00000103152
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
PDB:3KVO|B 1 174 1e-98 PDB
low complexity region 175 247 N/A INTRINSIC
Pfam:SCP2 262 364 2.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128792
AA Change: N16I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119139
Gene: ENSMUSG00000028383
AA Change: N16I

DomainStartEndE-ValueType
SCOP:d1hu4a_ 9 122 1e-19 SMART
PDB:3KVO|B 9 149 8e-83 PDB
Meta Mutation Damage Score 0.9666 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Hsdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Hsdl2 APN 4 59596892 missense probably benign 0.26
IGL00857:Hsdl2 APN 4 59617735 missense probably benign 0.29
IGL01859:Hsdl2 APN 4 59601569 critical splice donor site probably null
IGL02822:Hsdl2 APN 4 59601379 missense possibly damaging 0.55
IGL03028:Hsdl2 APN 4 59594471 missense probably damaging 0.98
IGL03275:Hsdl2 APN 4 59617747 makesense probably null
R0217:Hsdl2 UTSW 4 59597311 missense probably damaging 1.00
R0294:Hsdl2 UTSW 4 59601408 missense probably benign 0.00
R0448:Hsdl2 UTSW 4 59606523 missense unknown
R0490:Hsdl2 UTSW 4 59612814 splice site probably benign
R1353:Hsdl2 UTSW 4 59596971 splice site probably null
R1668:Hsdl2 UTSW 4 59612697 missense probably damaging 1.00
R3933:Hsdl2 UTSW 4 59597274 missense probably damaging 1.00
R4088:Hsdl2 UTSW 4 59610636 missense unknown
R4449:Hsdl2 UTSW 4 59617692 missense possibly damaging 0.61
R4723:Hsdl2 UTSW 4 59593270 unclassified probably benign
R4858:Hsdl2 UTSW 4 59612812 critical splice donor site probably null
R5361:Hsdl2 UTSW 4 59592301 unclassified probably benign
R6435:Hsdl2 UTSW 4 59610668 missense unknown
R6525:Hsdl2 UTSW 4 59612696 missense probably damaging 0.99
R6536:Hsdl2 UTSW 4 59610508 critical splice acceptor site probably null
R7156:Hsdl2 UTSW 4 59617653 missense possibly damaging 0.78
R7740:Hsdl2 UTSW 4 59612724 missense probably damaging 0.99
RF005:Hsdl2 UTSW 4 59610652 small insertion probably benign
RF013:Hsdl2 UTSW 4 59610657 small insertion probably benign
RF015:Hsdl2 UTSW 4 59610640 small insertion probably benign
RF016:Hsdl2 UTSW 4 59610643 small insertion probably benign
RF020:Hsdl2 UTSW 4 59610640 small insertion probably benign
RF023:Hsdl2 UTSW 4 59610644 small insertion probably benign
RF025:Hsdl2 UTSW 4 59610637 small insertion probably benign
RF026:Hsdl2 UTSW 4 59610655 small insertion probably benign
RF028:Hsdl2 UTSW 4 59610650 nonsense probably null
RF030:Hsdl2 UTSW 4 59610647 small insertion probably benign
RF038:Hsdl2 UTSW 4 59610648 small insertion probably benign
RF049:Hsdl2 UTSW 4 59610633 small insertion probably benign
RF049:Hsdl2 UTSW 4 59610651 small insertion probably benign
RF051:Hsdl2 UTSW 4 59610636 small insertion probably benign
RF051:Hsdl2 UTSW 4 59610650 small insertion probably benign
RF056:Hsdl2 UTSW 4 59610647 frame shift probably null
RF059:Hsdl2 UTSW 4 59610658 small insertion probably benign
RF060:Hsdl2 UTSW 4 59610608 small insertion probably benign
RF061:Hsdl2 UTSW 4 59610657 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCAATCGTAGCGTCTAAGT -3'
(R):5'- CCCTCTGTTTCTGGGTAGTTAA -3'

Sequencing Primer
(F):5'- GGTCAATCGTAGCGTCTAAGTATATC -3'
(R):5'- GGGTAGTTAAGTTCTCTGAGAAAAC -3'
Posted On2015-06-12