Incidental Mutation 'R8239:Grasp'
ID637529
Institutional Source Beutler Lab
Gene Symbol Grasp
Ensembl Gene ENSMUSG00000000531
Gene NameGRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Synonymstamalin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101224188-101232756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101231021 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 217 (L217F)
Ref Sequence ENSEMBL: ENSMUSP00000000543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000543]
Predicted Effect probably damaging
Transcript: ENSMUST00000000543
AA Change: L217F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000543
Gene: ENSMUSG00000000531
AA Change: L217F

DomainStartEndE-ValueType
low complexity region 30 57 N/A INTRINSIC
PDZ 109 189 2.12e-13 SMART
low complexity region 248 277 N/A INTRINSIC
low complexity region 291 312 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a molecular scaffold, linking receptors, including group 1 metabotropic glutamate receptors, to neuronal proteins. The encoded protein contains conserved domains, including a leucine zipper sequence, PDZ domain and a C-terminal PDZ-binding motif. Alternately spliced transcript variants have been observed for this gene.[provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted null mutations develop and behave normally under ordinary conditions but display a marked reduction in sensitivity to acute morphine responses and impaired adaptive responses to morphine and cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Grasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Grasp APN 15 101228896 splice site probably benign
IGL02069:Grasp APN 15 101224465 missense probably damaging 1.00
IGL02516:Grasp APN 15 101229051 missense probably damaging 1.00
IGL02997:Grasp APN 15 101231018 missense probably damaging 1.00
IGL03079:Grasp APN 15 101230567 missense probably damaging 1.00
R0020:Grasp UTSW 15 101230552 missense probably damaging 1.00
R0020:Grasp UTSW 15 101230552 missense probably damaging 1.00
R1916:Grasp UTSW 15 101226969 splice site probably benign
R1952:Grasp UTSW 15 101224500 missense probably benign 0.07
R4247:Grasp UTSW 15 101224537 missense possibly damaging 0.55
R5040:Grasp UTSW 15 101229042 missense probably damaging 1.00
R5117:Grasp UTSW 15 101230537 missense probably damaging 1.00
R7290:Grasp UTSW 15 101231538 missense probably damaging 1.00
R8141:Grasp UTSW 15 101231909 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCAAGAAAGTATGGGCTCTGC -3'
(R):5'- CGCCTCTTAAGACAGGAAAGC -3'

Sequencing Primer
(F):5'- CTCCTCCGGCCCTTTTAAGG -3'
(R):5'- GTCCGAGGACTTACTACTGTAGAC -3'
Posted On2020-07-13