Incidental Mutation 'R4281:Usp47'
ID322896
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Nameubiquitin specific peptidase 47
SynonymsA630020C16Rik, 4930502N04Rik
MMRRC Submission 041649-MU
Accession Numbers

Genbank: NM_133758; MGI: 1922246

Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R4281 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location112023504-112111661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112109993 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1315 (E1315D)
Ref Sequence ENSEMBL: ENSMUSP00000102264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
Predicted Effect probably benign
Transcript: ENSMUST00000106653
AA Change: E1315D

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: E1315D

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210309
AA Change: E1335D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000215510
AA Change: E1335D

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 92% (44/48)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
B9d2 A G 7: 25,681,426 T14A possibly damaging Het
Cavin3 A C 7: 105,481,774 probably null Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Evc2 T C 5: 37,338,594 V16A probably benign Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Gimap8 A C 6: 48,658,820 R506S probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Gtf2a1l A G 17: 88,711,637 N383S possibly damaging Het
Hepacam2 G A 6: 3,475,938 T329I probably damaging Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Lrrc6 A T 15: 66,380,529 H429Q probably benign Het
Mark4 T C 7: 19,433,446 K456R probably benign Het
Nox4 A G 7: 87,297,524 I143V possibly damaging Het
Olfr530 A G 7: 140,373,472 I46T probably benign Het
Olfr746 T C 14: 50,653,572 C112R probably benign Het
Pcdh18 A G 3: 49,756,533 L111P possibly damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Pnpla6 T C 8: 3,521,513 L148P probably damaging Het
Prkdc A G 16: 15,806,099 probably null Het
Rars T C 11: 35,821,224 E275G probably damaging Het
Rasa3 A G 8: 13,588,946 V287A probably benign Het
Rimbp2 C T 5: 128,788,340 R641Q possibly damaging Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tmem132a C G 19: 10,861,726 E451Q possibly damaging Het
Tmem229b-ps A G 10: 53,475,378 noncoding transcript Het
Trim33 T A 3: 103,329,086 V504D probably damaging Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp612 A G 8: 110,090,059 I594V probably damaging Het
Zfp692 T C 11: 58,314,265 F447L probably damaging Het
Zranb3 A C 1: 127,963,877 S787R possibly damaging Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 112074783 missense probably benign 0.00
IGL00574:Usp47 APN 7 112063335 missense probably damaging 1.00
IGL00975:Usp47 APN 7 112093370 missense probably damaging 1.00
IGL01289:Usp47 APN 7 112063358 missense probably damaging 1.00
IGL01419:Usp47 APN 7 112087911 missense possibly damaging 0.94
IGL01645:Usp47 APN 7 112054862 missense probably damaging 0.96
IGL01871:Usp47 APN 7 112077786 splice site probably benign
IGL02066:Usp47 APN 7 112064397 missense probably damaging 1.00
IGL02122:Usp47 APN 7 112106908 missense probably damaging 0.97
IGL02153:Usp47 APN 7 112104049 missense probably benign 0.00
IGL02550:Usp47 APN 7 112104354 missense probably damaging 1.00
IGL02710:Usp47 APN 7 112092925 missense probably benign 0.01
IGL02756:Usp47 APN 7 112093063 missense possibly damaging 0.76
IGL03093:Usp47 APN 7 112089620 missense probably damaging 1.00
IGL03398:Usp47 APN 7 112074503 missense probably damaging 1.00
0152:Usp47 UTSW 7 112056577 missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 112104341 splice site probably benign
R0110:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0381:Usp47 UTSW 7 112063393 critical splice donor site probably null
R0450:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0634:Usp47 UTSW 7 112108655 missense probably damaging 1.00
R0881:Usp47 UTSW 7 112091436 missense possibly damaging 0.51
R1178:Usp47 UTSW 7 112109998 missense possibly damaging 0.68
R1447:Usp47 UTSW 7 112074568 critical splice donor site probably null
R1640:Usp47 UTSW 7 112083127 missense probably damaging 0.99
R1727:Usp47 UTSW 7 112086100 missense probably damaging 0.96
R1866:Usp47 UTSW 7 112101870 missense possibly damaging 0.93
R1876:Usp47 UTSW 7 112054920 missense probably damaging 0.99
R1953:Usp47 UTSW 7 112092876 missense probably benign 0.26
R2117:Usp47 UTSW 7 112067236 critical splice donor site probably null
R2176:Usp47 UTSW 7 112092727 missense probably benign 0.00
R2187:Usp47 UTSW 7 112067191 missense probably damaging 1.00
R2504:Usp47 UTSW 7 112104470 critical splice donor site probably null
R2902:Usp47 UTSW 7 112093451 missense probably damaging 1.00
R2922:Usp47 UTSW 7 112093198 missense probably damaging 1.00
R2939:Usp47 UTSW 7 112082536 missense probably damaging 1.00
R4065:Usp47 UTSW 7 112053416 missense probably benign 0.30
R4179:Usp47 UTSW 7 112087884 missense probably damaging 1.00
R4235:Usp47 UTSW 7 112110048 missense probably damaging 0.99
R4243:Usp47 UTSW 7 112108629 missense probably damaging 1.00
R4360:Usp47 UTSW 7 112054932 missense probably damaging 1.00
R4604:Usp47 UTSW 7 112101831 missense probably damaging 1.00
R4857:Usp47 UTSW 7 112082552 missense probably damaging 1.00
R5133:Usp47 UTSW 7 112083882 missense probably damaging 1.00
R5179:Usp47 UTSW 7 112093432 missense probably damaging 1.00
R5322:Usp47 UTSW 7 112053269 missense probably damaging 0.99
R5445:Usp47 UTSW 7 112074721 missense probably damaging 1.00
R5465:Usp47 UTSW 7 112059002 missense probably damaging 1.00
R5699:Usp47 UTSW 7 112109997 missense probably benign 0.00
R5961:Usp47 UTSW 7 112053316 missense probably damaging 1.00
R6117:Usp47 UTSW 7 112087932 missense probably damaging 0.98
R6271:Usp47 UTSW 7 112087056 missense probably damaging 1.00
R7155:Usp47 UTSW 7 112087013 missense probably damaging 0.97
R7229:Usp47 UTSW 7 112092877 missense probably benign 0.04
R7246:Usp47 UTSW 7 112115909
R7285:Usp47 UTSW 7 112093108 missense probably benign 0.02
R7938:Usp47 UTSW 7 112087925 missense probably damaging 0.99
R8079:Usp47 UTSW 7 112046970 missense probably damaging 1.00
R8114:Usp47 UTSW 7 112093187 missense probably damaging 1.00
R8141:Usp47 UTSW 7 112053265 missense possibly damaging 0.60
R8172:Usp47 UTSW 7 112087926 nonsense probably null
R8223:Usp47 UTSW 7 112104376 missense probably damaging 1.00
R8510:Usp47 UTSW 7 112059001 missense probably damaging 1.00
RF010:Usp47 UTSW 7 112092938 missense probably damaging 0.99
X0027:Usp47 UTSW 7 112087847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGTGCACATGTGATTCC -3'
(R):5'- AACCATGTCCGGCCAAAATG -3'

Sequencing Primer
(F):5'- GTGATTCCCATTAGCAACCTAGTG -3'
(R):5'- TGGCACTACCCAGCAGTAG -3'
Posted On2015-06-20