Incidental Mutation 'R4405:Kcna10'
ID327597
Institutional Source Beutler Lab
Gene Symbol Kcna10
Ensembl Gene ENSMUSG00000042861
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 10
SynonymsKcna8, Kv1.8
MMRRC Submission 041134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4405 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107183056-107195721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107195465 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 471 (E471K)
Ref Sequence ENSEMBL: ENSMUSP00000088118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055064]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055064
AA Change: E471K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088118
Gene: ENSMUSG00000042861
AA Change: E471K

DomainStartEndE-ValueType
BTB 86 186 1.07e-6 SMART
Pfam:Ion_trans 215 468 3.4e-51 PFAM
Pfam:Ion_trans_2 376 461 6.2e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It is specifically regulated by cGMP and postulated to mediate the effects of substances that increase intracellular cGMP. This gene is intronless, and the gene is clustered with genes KCNA2 and KCNA3 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significant vestibular and mild hearing dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 C T 8: 95,036,908 A279V probably benign Het
Aggf1 G A 13: 95,371,594 P88L probably benign Het
Asb18 T C 1: 89,968,689 T210A probably benign Het
Cd8b1 C T 6: 71,326,022 S27L possibly damaging Het
Cfap43 C T 19: 47,739,797 S1507N possibly damaging Het
Col12a1 A T 9: 79,639,965 probably null Het
Col19a1 G A 1: 24,534,109 T194M unknown Het
Cpb1 T A 3: 20,263,569 T237S probably benign Het
Cubn G A 2: 13,466,030 T517M probably damaging Het
Dnah6 T C 6: 73,129,291 N1769S probably benign Het
Dnm1 A G 2: 32,335,972 I365T probably damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Etv6 A G 6: 134,233,534 E115G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gapvd1 C T 2: 34,728,735 V209I probably damaging Het
Gbp8 G A 5: 105,051,062 probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Grb14 T C 2: 64,953,622 N54D probably damaging Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
Herc2 T A 7: 56,170,477 L2849Q probably damaging Het
Hsd17b4 G T 18: 50,128,314 probably benign Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Iqcd A T 5: 120,602,420 E272V probably damaging Het
Itih2 A T 2: 10,106,737 Y463* probably null Het
Klf3 A T 5: 64,829,004 E294V possibly damaging Het
Lancl1 A T 1: 67,020,856 probably null Het
Lrig3 T C 10: 126,011,008 F882L probably benign Het
Man2c1 A G 9: 57,139,083 N474S probably damaging Het
Map4k3 A G 17: 80,615,015 probably null Het
Mast1 C A 8: 84,920,891 W572C probably damaging Het
Mbd4 T A 6: 115,849,115 Q305L possibly damaging Het
Mbl2 T A 19: 30,239,516 S243T probably benign Het
Mcph1 C T 8: 18,632,541 P565S probably benign Het
Mfsd1 G C 3: 67,600,610 V435L probably benign Het
Mycbp2 C T 14: 103,123,445 G1183D probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Noa1 A T 5: 77,306,372 S474T probably benign Het
Nrde2 A G 12: 100,130,584 Y986H probably benign Het
Oca2 G T 7: 56,414,434 V726F possibly damaging Het
Olfr57 A T 10: 79,035,410 M205L probably benign Het
Olfr695 T A 7: 106,873,373 S291C probably damaging Het
Pip5k1a A G 3: 95,068,059 probably null Het
Plekhn1 A T 4: 156,225,273 probably null Het
Sec61a2 T C 2: 5,882,859 D104G probably benign Het
Slc25a36 T C 9: 97,085,118 T131A probably benign Het
Slc5a11 A T 7: 123,258,477 D263V probably damaging Het
Sorbs1 T C 19: 40,395,745 I35V probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tbc1d1 T C 5: 64,173,670 V64A possibly damaging Het
Tmem159 T G 7: 120,115,491 F68V probably damaging Het
Ttc37 A T 13: 76,155,665 Y1234F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r20 A G 6: 57,432,057 M123V probably benign Het
Zwint T C 10: 72,656,263 L59P probably damaging Het
Other mutations in Kcna10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Kcna10 APN 3 107194728 missense probably damaging 1.00
IGL00481:Kcna10 APN 3 107195514 missense probably benign
IGL00645:Kcna10 APN 3 107195465 missense possibly damaging 0.95
IGL00974:Kcna10 APN 3 107195331 missense probably damaging 1.00
IGL03108:Kcna10 APN 3 107194943 missense probably benign 0.00
R0020:Kcna10 UTSW 3 107195420 missense probably damaging 1.00
R0421:Kcna10 UTSW 3 107194504 missense probably damaging 1.00
R0811:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R0812:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R2176:Kcna10 UTSW 3 107194716 missense probably damaging 1.00
R4668:Kcna10 UTSW 3 107194694 missense possibly damaging 0.83
R4703:Kcna10 UTSW 3 107194610 missense probably benign 0.22
R4719:Kcna10 UTSW 3 107194901 missense probably benign
R4736:Kcna10 UTSW 3 107195492 missense probably benign
R5227:Kcna10 UTSW 3 107194428 missense probably damaging 1.00
R5564:Kcna10 UTSW 3 107194229 missense probably benign
R5735:Kcna10 UTSW 3 107195078 missense probably benign
R7418:Kcna10 UTSW 3 107195046 missense probably benign 0.12
R7464:Kcna10 UTSW 3 107194079 missense probably damaging 0.99
R7699:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7700:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7978:Kcna10 UTSW 3 107194347 missense probably damaging 1.00
R8068:Kcna10 UTSW 3 107194410 missense possibly damaging 0.58
R8744:Kcna10 UTSW 3 107194386 missense probably damaging 1.00
X0026:Kcna10 UTSW 3 107195157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCCTGATGGCTTCTGG -3'
(R):5'- TGTGTTGAGAAGAAACAGCCC -3'

Sequencing Primer
(F):5'- GTGGGCTGTGGTCACCATG -3'
(R):5'- AGCTCACAGAGATGGCCTC -3'
Posted On2015-07-07