Incidental Mutation 'R4409:Msc'
ID327781
Institutional Source Beutler Lab
Gene Symbol Msc
Ensembl Gene ENSMUSG00000025930
Gene Namemusculin
SynonymsbHLHa22, MyoR
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location14753346-14755992 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 14755678 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 24 (P24R)
Ref Sequence ENSEMBL: ENSMUSP00000027062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027062] [ENSMUST00000190719]
Predicted Effect probably damaging
Transcript: ENSMUST00000027062
AA Change: P24R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027062
Gene: ENSMUSG00000025930
AA Change: P24R

DomainStartEndE-ValueType
low complexity region 48 55 N/A INTRINSIC
low complexity region 66 94 N/A INTRINSIC
HLH 108 160 1.8e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067599
SMART Domains Protein: ENSMUSP00000063770
Gene: ENSMUSG00000054493

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190471
Predicted Effect probably benign
Transcript: ENSMUST00000190719
SMART Domains Protein: ENSMUSP00000140741
Gene: ENSMUSG00000025930

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional repressor capable of binding an E-box element either as a homodimer or as a heterodimer with E2A in vitro. The encoded protein also forms heterodimers with E2A proteins in vivo. This protein is capable of inhibiting the transactivation capability of E47, an E2A protein, in mammalian cells. This gene is a downstream target of the B-cell receptor signal transduction pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are obtained at predicted Mendelian ratios and exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Msc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2081:Msc UTSW 1 14755717 missense probably benign 0.24
R2094:Msc UTSW 1 14755684 missense probably benign 0.27
R2495:Msc UTSW 1 14755249 missense probably benign 0.14
R4470:Msc UTSW 1 14755678 missense probably damaging 0.97
R4471:Msc UTSW 1 14755678 missense probably damaging 0.97
R4654:Msc UTSW 1 14755829 unclassified probably null
R5073:Msc UTSW 1 14754313 missense probably benign 0.02
R5385:Msc UTSW 1 14755420 missense probably damaging 1.00
R5399:Msc UTSW 1 14755556 missense probably benign 0.01
R6547:Msc UTSW 1 14755745 missense possibly damaging 0.95
R6799:Msc UTSW 1 14755267 missense probably damaging 0.99
Z1176:Msc UTSW 1 14755239 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTCTGGAGAAGGCTTTGC -3'
(R):5'- TACAGGGTCAGCAGCAGATC -3'

Sequencing Primer
(F):5'- AGAAGGCTTTGCTCAGCAC -3'
(R):5'- AAGCCCTGGTCTCTGGTC -3'
Posted On2015-07-07