Incidental Mutation 'R4571:Wnt9a'
ID342150
Institutional Source Beutler Lab
Gene Symbol Wnt9a
Ensembl Gene ENSMUSG00000000126
Gene Namewingless-type MMTV integration site family, member 9A
SynonymsWnt14
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4571 (G1)
Quality Score194
Status Validated
Chromosome11
Chromosomal Location59306928-59333552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59331337 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 354 (C354R)
Ref Sequence ENSEMBL: ENSMUSP00000104411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000128] [ENSMUST00000108783]
Predicted Effect probably damaging
Transcript: ENSMUST00000000128
AA Change: C354R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000128
Gene: ENSMUSG00000000126
AA Change: C354R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 37 52 N/A INTRINSIC
WNT1 59 364 5.57e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108783
AA Change: C354R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104411
Gene: ENSMUSG00000000126
AA Change: C354R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 37 52 N/A INTRINSIC
WNT1 59 364 8.97e-86 SMART
Meta Mutation Damage Score 0.9667 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in neonatal lethality, altered chondrocyte maturation, cranial defects, and skeletal abnormalities including shortened appendicular long bones, partial joint fusions of carpal and tarsal elements, and chondroid metaplasia in synovial and fibrous joints. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Wnt9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02526:Wnt9a APN 11 59328505 missense probably damaging 0.99
IGL02550:Wnt9a APN 11 59330918 missense probably damaging 1.00
IGL03131:Wnt9a APN 11 59331029 missense probably damaging 0.97
IGL03347:Wnt9a APN 11 59330914 missense probably damaging 1.00
R1764:Wnt9a UTSW 11 59330902 missense probably benign 0.13
R2073:Wnt9a UTSW 11 59331229 missense probably damaging 1.00
R4502:Wnt9a UTSW 11 59328537 missense probably damaging 1.00
R4845:Wnt9a UTSW 11 59331241 missense probably benign 0.24
R5268:Wnt9a UTSW 11 59328570 missense probably damaging 1.00
R7501:Wnt9a UTSW 11 59328757 missense probably damaging 0.99
Z1177:Wnt9a UTSW 11 59331163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGAGCTTGTACACCTG -3'
(R):5'- ACTCCATGCAGATTAAGACCCTTTG -3'

Sequencing Primer
(F):5'- AGCTTGTACACCTGGACGACTC -3'
(R):5'- GCAGATTAAGACCCTTTGCACTATG -3'
Posted On2015-09-24