Incidental Mutation 'R0268:Klhl35'
ID35070
Institutional Source Beutler Lab
Gene Symbol Klhl35
Ensembl Gene ENSMUSG00000035298
Gene Namekelch-like 35
Synonyms
MMRRC Submission 038494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R0268 (G1)
Quality Score151
Status Validated
Chromosome7
Chromosomal Location99466004-99474022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99471751 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 409 (S409T)
Ref Sequence ENSEMBL: ENSMUSP00000041363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037359] [ENSMUST00000152424]
Predicted Effect probably benign
Transcript: ENSMUST00000037359
AA Change: S409T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041363
Gene: ENSMUSG00000035298
AA Change: S409T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
BTB 40 141 5.82e-17 SMART
BACK 146 248 1.21e-27 SMART
Kelch 292 341 6.32e-2 SMART
Kelch 342 385 1.18e-5 SMART
Kelch 386 432 3.01e-12 SMART
Kelch 433 480 2.23e-1 SMART
Kelch 481 522 2.71e-5 SMART
Kelch 523 570 1.39e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142339
Predicted Effect probably benign
Transcript: ENSMUST00000152424
SMART Domains Protein: ENSMUSP00000120346
Gene: ENSMUSG00000035298

DomainStartEndE-ValueType
Pfam:Kelch_1 1 34 1.1e-8 PFAM
Pfam:Kelch_6 36 79 3.6e-8 PFAM
Pfam:Kelch_1 38 76 2.6e-7 PFAM
low complexity region 106 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153736
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gls GGCTGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTGCTG 1: 52,232,694 probably benign Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Klhl35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Klhl35 APN 7 99471681 splice site probably benign
IGL03003:Klhl35 APN 7 99470343 missense probably damaging 0.98
R1563:Klhl35 UTSW 7 99471695 missense probably damaging 1.00
R1770:Klhl35 UTSW 7 99473875 missense possibly damaging 0.57
R1901:Klhl35 UTSW 7 99470220 missense probably damaging 1.00
R2392:Klhl35 UTSW 7 99473824 missense possibly damaging 0.72
R3810:Klhl35 UTSW 7 99470241 missense probably benign 0.07
R4194:Klhl35 UTSW 7 99473851 unclassified probably null
R4349:Klhl35 UTSW 7 99473719 missense probably benign 0.18
R4960:Klhl35 UTSW 7 99469068 missense probably damaging 1.00
R5846:Klhl35 UTSW 7 99472887 missense probably damaging 0.97
R6161:Klhl35 UTSW 7 99473337 unclassified probably benign
R6494:Klhl35 UTSW 7 99472899 missense probably damaging 1.00
R7060:Klhl35 UTSW 7 99468458 missense possibly damaging 0.81
R7758:Klhl35 UTSW 7 99473218 missense unknown
R7762:Klhl35 UTSW 7 99468440 missense probably benign 0.11
X0023:Klhl35 UTSW 7 99470341 nonsense probably null
X0064:Klhl35 UTSW 7 99471841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTTCAGCAGTCAAAGACAGGAAG -3'
(R):5'- TGCCCAGATCTAGCCTGCACATAG -3'

Sequencing Primer
(F):5'- GGGTTGTAAACCCTTAGTAACCAC -3'
(R):5'- GCACATAGTAGGCTATACTGTTTCC -3'
Posted On2013-05-09