Incidental Mutation 'R0269:Sema6d'
ID35129
Institutional Source Beutler Lab
Gene Symbol Sema6d
Ensembl Gene ENSMUSG00000027200
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
SynonymsSema6D-6, 1110067B02Rik, Sema6D-1, Sema6D-2, Sema6D-4, Sema6D-5
MMRRC Submission 038495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0269 (G1)
Quality Score206
Status Validated
Chromosome2
Chromosomal Location124089969-124667770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124660745 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 583 (F583L)
Ref Sequence ENSEMBL: ENSMUSP00000099529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051419] [ENSMUST00000076335] [ENSMUST00000077847] [ENSMUST00000078621] [ENSMUST00000103238] [ENSMUST00000103239] [ENSMUST00000103240] [ENSMUST00000103241]
Predicted Effect probably benign
Transcript: ENSMUST00000051419
SMART Domains Protein: ENSMUSP00000061123
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 743 764 N/A INTRINSIC
internal_repeat_1 797 898 7.43e-5 PROSPERO
internal_repeat_1 892 1004 7.43e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000076335
SMART Domains Protein: ENSMUSP00000075674
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000077847
SMART Domains Protein: ENSMUSP00000077014
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000078621
AA Change: F596L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000077691
Gene: ENSMUSG00000027200
AA Change: F596L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 762 783 N/A INTRINSIC
internal_repeat_1 816 917 8.83e-5 PROSPERO
internal_repeat_1 911 1023 8.83e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103238
SMART Domains Protein: ENSMUSP00000099528
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103239
AA Change: F583L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099529
Gene: ENSMUSG00000027200
AA Change: F583L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
low complexity region 805 826 N/A INTRINSIC
internal_repeat_1 859 960 5.78e-5 PROSPERO
internal_repeat_1 954 1066 5.78e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103240
AA Change: F583L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099530
Gene: ENSMUSG00000027200
AA Change: F583L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 801 822 N/A INTRINSIC
internal_repeat_1 855 956 5.63e-5 PROSPERO
internal_repeat_1 950 1062 5.63e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103241
SMART Domains Protein: ENSMUSP00000099531
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132088
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.1%
  • 20x: 93.6%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal dendritic cell trafficking and antigen-specific T cell priming. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,954,000 V231I possibly damaging Het
Abca1 T C 4: 53,044,228 D1798G probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Amhr2 T C 15: 102,447,068 C189R probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
AW551984 T C 9: 39,599,950 Y153C probably damaging Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Cd46 T G 1: 195,064,688 I339L probably benign Het
Cdkn2aip A G 8: 47,711,977 S234P probably damaging Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Csf2rb2 G T 15: 78,288,865 T265N probably benign Het
Cyp2c40 A G 19: 39,773,896 F436L probably damaging Het
D130040H23Rik T C 8: 69,300,794 F24S probably benign Het
Defb12 G T 8: 19,114,359 A34E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Gldc T A 19: 30,118,602 I670F probably damaging Het
Guf1 A C 5: 69,559,599 Q168P probably damaging Het
Hcn2 A G 10: 79,734,241 probably benign Het
Hddc2 A G 10: 31,327,946 M190V probably benign Het
Kcnq2 T C 2: 181,096,974 E294G probably benign Het
Kdelr1 T A 7: 45,874,039 probably benign Het
Kidins220 T A 12: 25,040,512 H1158Q probably damaging Het
Laptm5 A T 4: 130,930,816 N185Y probably benign Het
Mgat4a A G 1: 37,490,307 Y164H possibly damaging Het
Mlh3 C A 12: 85,268,405 V336L probably benign Het
Myadm A G 7: 3,296,757 T12A unknown Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr954 T C 9: 39,461,794 M118T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Recql5 T C 11: 115,928,224 D172G possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Rgs7 A G 1: 175,270,820 S58P possibly damaging Het
Sgsm1 T C 5: 113,286,929 probably null Het
Slc22a19 A T 19: 7,709,621 probably benign Het
Slc6a21 T A 7: 45,286,908 Y428* probably null Het
Smarca4 T G 9: 21,636,201 M260R probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata17 T C 1: 187,097,872 I322V probably benign Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Sult1d1 A T 5: 87,564,802 I61N probably damaging Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Trmt11 T A 10: 30,587,489 H210L probably benign Het
Ush2a T A 1: 188,810,176 M3313K probably benign Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Other mutations in Sema6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Sema6d APN 2 124659865 missense possibly damaging 0.91
IGL00508:Sema6d APN 2 124656924 splice site probably benign
IGL00710:Sema6d APN 2 124662288 missense probably benign 0.00
IGL00811:Sema6d APN 2 124658469 missense probably damaging 1.00
IGL01457:Sema6d APN 2 124653642 missense unknown
IGL01524:Sema6d APN 2 124664075 missense possibly damaging 0.86
IGL01598:Sema6d APN 2 124665098 missense probably damaging 1.00
IGL01915:Sema6d APN 2 124658571 splice site probably benign
IGL02365:Sema6d APN 2 124656868 missense probably benign 0.14
IGL02698:Sema6d APN 2 124653723 missense possibly damaging 0.95
IGL02865:Sema6d APN 2 124664073 missense probably damaging 1.00
IGL03018:Sema6d APN 2 124659600 missense possibly damaging 0.95
IGL03333:Sema6d APN 2 124664370 missense possibly damaging 0.83
R0390:Sema6d UTSW 2 124658490 missense probably damaging 1.00
R0541:Sema6d UTSW 2 124665277 missense probably benign 0.25
R0615:Sema6d UTSW 2 124654135 splice site probably benign
R0617:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0694:Sema6d UTSW 2 124664041 missense probably damaging 1.00
R0854:Sema6d UTSW 2 124665302 missense probably damaging 0.97
R1630:Sema6d UTSW 2 124664345 missense possibly damaging 0.89
R1682:Sema6d UTSW 2 124665149 missense probably benign 0.21
R1823:Sema6d UTSW 2 124659556 splice site probably null
R1932:Sema6d UTSW 2 124659886 critical splice donor site probably null
R2249:Sema6d UTSW 2 124659588 missense possibly damaging 0.54
R2256:Sema6d UTSW 2 124664150 missense probably damaging 1.00
R2331:Sema6d UTSW 2 124658063 missense probably damaging 1.00
R2910:Sema6d UTSW 2 124665037 missense probably damaging 1.00
R3683:Sema6d UTSW 2 124654226 missense possibly damaging 0.88
R3937:Sema6d UTSW 2 124656850 missense probably benign 0.00
R4135:Sema6d UTSW 2 124664120 missense probably damaging 0.96
R4446:Sema6d UTSW 2 124664059 missense probably damaging 0.98
R4583:Sema6d UTSW 2 124664162 missense probably damaging 1.00
R4599:Sema6d UTSW 2 124654231 missense probably damaging 1.00
R4822:Sema6d UTSW 2 124662294 missense possibly damaging 0.79
R4884:Sema6d UTSW 2 124656818 splice site probably null
R5288:Sema6d UTSW 2 124664246 missense probably damaging 1.00
R5443:Sema6d UTSW 2 124656836 missense probably damaging 1.00
R5504:Sema6d UTSW 2 124658021 missense probably damaging 1.00
R5534:Sema6d UTSW 2 124659815 missense possibly damaging 0.75
R5615:Sema6d UTSW 2 124656901 missense probably damaging 0.97
R5747:Sema6d UTSW 2 124664947 missense probably damaging 0.99
R5866:Sema6d UTSW 2 124664342 missense probably benign 0.26
R5980:Sema6d UTSW 2 124664708 missense probably damaging 1.00
R6670:Sema6d UTSW 2 124654842 small deletion probably benign
R6803:Sema6d UTSW 2 124664050 missense probably damaging 0.96
R7023:Sema6d UTSW 2 124664911 missense probably damaging 1.00
R7068:Sema6d UTSW 2 124657821 missense probably benign
R7426:Sema6d UTSW 2 124654158 missense probably damaging 1.00
R7556:Sema6d UTSW 2 124654189 missense probably damaging 1.00
R7569:Sema6d UTSW 2 124657972 missense possibly damaging 0.92
R8427:Sema6d UTSW 2 124665277 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCAGCCTTGATAATGACTCGGGAC -3'
(R):5'- TGAACCATTCCATGCTACACACGG -3'

Sequencing Primer
(F):5'- CTTGATAATGACTCGGGACACATAG -3'
(R):5'- GGCTGAGTAAGAAAACATCTCTC -3'
Posted On2013-05-09