Incidental Mutation 'R0402:Uroc1'
ID35614
Institutional Source Beutler Lab
Gene Symbol Uroc1
Ensembl Gene ENSMUSG00000034456
Gene Nameurocanase domain containing 1
Synonyms
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0402 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location90333284-90364551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90347302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 436 (D436G)
Ref Sequence ENSEMBL: ENSMUSP00000127114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046128] [ENSMUST00000164761]
Predicted Effect probably damaging
Transcript: ENSMUST00000046128
AA Change: D402G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040424
Gene: ENSMUSG00000034456
AA Change: D402G

DomainStartEndE-ValueType
Pfam:Urocanase 84 662 2.7e-231 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164761
AA Change: D436G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127114
Gene: ENSMUSG00000034456
AA Change: D436G

DomainStartEndE-ValueType
Pfam:Urocanase 85 316 1.4e-102 PFAM
Pfam:Urocanase 319 683 8.7e-144 PFAM
Meta Mutation Damage Score 0.9055 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in histidine catabolism, metabolizing urocanic acid to formiminoglutamic acid. The gene product is known to protect the skin from ultra violet rays and is contained in human sweat. Deficiency of this gene product in the liver is an apparent cause of mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Uroc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Uroc1 APN 6 90338828 missense probably benign
IGL01015:Uroc1 APN 6 90358901 splice site probably benign
IGL01386:Uroc1 APN 6 90346765 missense probably damaging 0.99
IGL01449:Uroc1 APN 6 90338653 missense probably damaging 1.00
IGL01514:Uroc1 APN 6 90363100 splice site probably benign
IGL02060:Uroc1 APN 6 90338255 missense probably benign 0.03
IGL02247:Uroc1 APN 6 90347928 missense probably benign 0.00
IGL02256:Uroc1 APN 6 90346687 missense possibly damaging 0.83
IGL02886:Uroc1 APN 6 90346829 splice site probably benign
IGL03087:Uroc1 APN 6 90363103 splice site probably benign
PIT4651001:Uroc1 UTSW 6 90363113 nonsense probably null
R0034:Uroc1 UTSW 6 90345310 missense probably damaging 1.00
R0245:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R0570:Uroc1 UTSW 6 90338564 missense possibly damaging 0.90
R0729:Uroc1 UTSW 6 90336955 missense probably damaging 1.00
R1471:Uroc1 UTSW 6 90344171 missense probably damaging 1.00
R1782:Uroc1 UTSW 6 90336919 missense probably damaging 1.00
R1866:Uroc1 UTSW 6 90361524 missense probably benign 0.03
R1983:Uroc1 UTSW 6 90345369 missense probably damaging 1.00
R2086:Uroc1 UTSW 6 90344114 missense probably damaging 1.00
R2321:Uroc1 UTSW 6 90347247 missense possibly damaging 0.94
R3720:Uroc1 UTSW 6 90346355 missense probably damaging 1.00
R3874:Uroc1 UTSW 6 90361512 nonsense probably null
R4628:Uroc1 UTSW 6 90355328 missense probably damaging 0.99
R4810:Uroc1 UTSW 6 90363153 missense probably damaging 1.00
R4820:Uroc1 UTSW 6 90357618 critical splice donor site probably null
R4838:Uroc1 UTSW 6 90349192 missense possibly damaging 0.90
R4880:Uroc1 UTSW 6 90357537 missense probably damaging 1.00
R4964:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R4966:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R5468:Uroc1 UTSW 6 90338604 missense probably benign 0.45
R5592:Uroc1 UTSW 6 90355344 missense probably damaging 0.99
R5698:Uroc1 UTSW 6 90347320 missense probably damaging 1.00
R5789:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R5853:Uroc1 UTSW 6 90346756 missense probably damaging 0.99
R6063:Uroc1 UTSW 6 90347928 missense probably benign 0.37
R6883:Uroc1 UTSW 6 90338592 nonsense probably null
R7374:Uroc1 UTSW 6 90338833 missense probably damaging 1.00
R7394:Uroc1 UTSW 6 90345333 missense probably damaging 1.00
R7427:Uroc1 UTSW 6 90346362 missense possibly damaging 0.56
R8376:Uroc1 UTSW 6 90337715 missense probably damaging 0.99
X0021:Uroc1 UTSW 6 90344150 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCTACAGGAGACTTTCTGGCACTGG -3'
(R):5'- AGTCACCTATCTGTGTGAGCACCC -3'

Sequencing Primer
(F):5'- GGTTTAGAAGGGTTTGGGGAG -3'
(R):5'- TGTCTGGCAGAACCAGCTTC -3'
Posted On2013-05-09