Mutagenetix > Incidental Mutation

Incidental Mutation 'R4734:Tspear'

359175

Institutional Source

Beutler Lab

Gene Symbol

Tspear

Ensembl Gene

ENSMUSG00000069581

Gene Name

thrombospondin type laminin G domain and EAR repeats

Synonyms

C330046G03Rik, ORF65

MMRRC Submission

041961-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R4734 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77686569-77887021 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 77864695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 120 (L120F)

Ref Sequence

ENSEMBL: ENSMUSP00000090020 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092366] [ENSMUST00000218443]

AlphaFold

J3S6Y1

Predicted Effect

probably damaging
Transcript: ENSMUST00000092366
AA Change: L120F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581
AA Change: L120F

Domain	Start	End	E-Value	Type
Blast:TSPN	1	71	8e-40	BLAST
SCOP:d1c4ra_	2	67	2e-7	SMART
low complexity region	190	200	N/A	INTRINSIC
Pfam:EPTP	208	255	2.6e-22	PFAM
Pfam:EPTP	260	307	1.4e-21	PFAM
Pfam:EPTP	312	359	8.9e-14	PFAM
Pfam:EPTP	362	417	6.2e-13	PFAM
Pfam:EPTP	422	469	1.3e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000092368

SMART Domains

Protein: ENSMUSP00000090022
Gene: ENSMUSG00000069581

Domain	Start	End	E-Value	Type
TSPN	3	174	2.24e-5	SMART
LamG	34	173	1.09e-1	SMART
low complexity region	293	303	N/A	INTRINSIC
Pfam:EPTP	311	357	3.4e-20	PFAM
Pfam:EPTP	362	409	4.9e-23	PFAM
Pfam:EPTP	414	461	3.1e-15	PFAM
Pfam:EPTP	464	519	2.2e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125241

Predicted Effect

probably benign
Transcript: ENSMUST00000218443

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,970,417	M86K	possibly damaging	Het
2700062C07Rik	A	G	18: 24,470,904	M1V	probably null	Het
Abcb11	T	A	2: 69,323,962	T87S	possibly damaging	Het
Arap3	A	G	18: 37,996,275	V210A	probably benign	Het
Avl9	T	C	6: 56,736,494	S246P	probably damaging	Het
Ccdc88a	A	G	11: 29,482,720	K222R	probably benign	Het
Chsy3	C	A	18: 59,179,413	F319L	probably benign	Het
Coro2b	T	C	9: 62,426,578	T345A	probably benign	Het
Cpb1	A	G	3: 20,263,712	V216A	probably benign	Het
Cyp2c65	A	G	19: 39,072,334	I213V	probably benign	Het
Dcaf15	A	G	8: 84,097,728	C586R	probably benign	Het
Ddr2	T	A	1: 169,998,088	E314D	probably benign	Het
Dennd5a	C	T	7: 109,896,336	R1196H	probably damaging	Het
Dnah9	G	A	11: 65,834,115	A4404V	probably damaging	Het
Dpf2	A	G	19: 5,906,999		probably null	Het
Eif2ak4	A	T	2: 118,422,087	H302L	probably damaging	Het
Eif2d	G	T	1: 131,165,152	R399L	probably damaging	Het
Fat2	A	G	11: 55,311,468	V260A	probably benign	Het
Fhod3	T	A	18: 25,028,135	Y575N	probably benign	Het
Fscb	T	C	12: 64,474,470	E74G	possibly damaging	Het
Gdpd2	G	A	X: 100,734,193	M243I	possibly damaging	Het
Glra1	C	A	11: 55,536,384	D42Y	probably damaging	Het
Gm281	T	C	14: 13,845,292	N540S	probably benign	Het
Gm8882	T	A	6: 132,361,928	N109I	unknown	Het
Gnl2	T	C	4: 125,041,018	F156L	probably benign	Het
Gpr37	C	A	6: 25,689,086	R4L	possibly damaging	Het
Hectd4	A	T	5: 121,341,977	H2892L	possibly damaging	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Htr2c	A	G	X: 147,193,797	T163A	probably benign	Het
Impact	T	A	18: 12,985,289	H188Q	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnx2	C	T	5: 147,029,137	G391R	probably damaging	Het
Lrrc19	T	C	4: 94,638,349	I324V	probably benign	Het
Lrrcc1	G	T	3: 14,562,285	Q458H	probably damaging	Het
Maml3	A	T	3: 51,689,875	D483E	probably damaging	Het
Mef2c	T	A	13: 83,662,629	*467R	probably null	Het
Mms19	T	A	19: 41,944,558	S1031C	probably damaging	Het
Myt1l	T	C	12: 29,919,926	I143T	possibly damaging	Het
Nuggc	T	C	14: 65,623,230	Y426H	probably damaging	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr464	T	A	11: 87,914,190	T239S	probably damaging	Het
Olfr470	T	C	7: 107,845,428	I102V	probably benign	Het
Olfr491	A	T	7: 108,317,752	N286I	probably damaging	Het
Olfr566	A	G	7: 102,856,979	I101T	probably damaging	Het
Oog2	T	C	4: 144,196,451	S429P	probably benign	Het
Pcnt	T	C	10: 76,437,206	D93G	probably benign	Het
Pdia5	A	T	16: 35,456,513	M95K	probably benign	Het
Pdzrn4	A	T	15: 92,770,252	R762*	probably null	Het
Piezo1	G	T	8: 122,498,206	Q654K	probably damaging	Het
Ppil3	A	G	1: 58,431,269	Y141H	probably benign	Het
Rassf8	G	T	6: 145,815,540	K197N	probably benign	Het
Ryr2	T	C	13: 11,737,753	Q1894R	probably damaging	Het
Ryr3	T	A	2: 112,910,502	N487Y	probably damaging	Het
Scn5a	T	C	9: 119,539,538	Y307C	probably damaging	Het
Sdad1	C	T	5: 92,304,977	R134Q	possibly damaging	Het
Shroom1	C	T	11: 53,465,233	S370F	probably damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc2a9	C	A	5: 38,382,099	G353C	probably damaging	Het
Snx33	T	A	9: 56,925,901	T295S	possibly damaging	Het
Spata31d1b	G	A	13: 59,718,358	V1107M	probably damaging	Het
Supt6	T	C	11: 78,224,683	D761G	probably benign	Het
Tfeb	T	C	17: 47,785,862	V18A	probably benign	Het
Thap12	G	T	7: 98,715,954	C443F	probably damaging	Het
Thap12	T	A	7: 98,715,955	C443*	probably null	Het
Tmem67	T	C	4: 12,063,158	D496G	probably benign	Het
Trappc8	G	A	18: 20,841,572	R900*	probably null	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Trmt1l	A	T	1: 151,442,637	I80L	probably benign	Het
Trpm5	C	A	7: 143,082,785	V472L	probably benign	Het
Ttc9b	G	A	7: 27,656,018	V238M	probably benign	Het
Usp20	A	G	2: 31,019,824	I819V	probably benign	Het
Vmn2r102	T	A	17: 19,677,533	V270E	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Zc3h18	A	T	8: 122,383,643	D77V	probably damaging	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het

Other mutations in Tspear

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Tspear	APN	10	77873236	missense	probably benign	0.30
IGL01726:Tspear	APN	10	77881287	intron	probably benign
IGL02244:Tspear	APN	10	77852856	unclassified	probably benign
IGL02393:Tspear	APN	10	77836573	missense	probably damaging	1.00
IGL02502:Tspear	APN	10	77852958	intron	probably benign
IGL02653:Tspear	APN	10	77706965	utr 3 prime	probably benign
IGL03345:Tspear	APN	10	77874882	splice site	probably null
R0058:Tspear	UTSW	10	77869631	missense	probably benign	0.07
R0058:Tspear	UTSW	10	77869631	missense	probably benign	0.07
R0542:Tspear	UTSW	10	77881087	missense	probably benign	0.14
R1384:Tspear	UTSW	10	77866332	missense	probably benign	0.44
R1467:Tspear	UTSW	10	77881192	missense	probably damaging	1.00
R1467:Tspear	UTSW	10	77881192	missense	probably damaging	1.00
R1545:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1625:Tspear	UTSW	10	77870499	missense	probably benign	0.20
R1635:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1636:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1637:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1744:Tspear	UTSW	10	77864884	splice site	probably null
R1749:Tspear	UTSW	10	77869673	missense	probably benign	0.00
R1768:Tspear	UTSW	10	77875116	critical splice donor site	probably null
R1774:Tspear	UTSW	10	77873185	missense	probably benign	0.01
R1791:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R1892:Tspear	UTSW	10	77870474	missense	probably benign	0.00
R2014:Tspear	UTSW	10	77875120	splice site	probably benign
R2108:Tspear	UTSW	10	77870419	missense	possibly damaging	0.48
R2248:Tspear	UTSW	10	77873269	missense	probably damaging	1.00
R3038:Tspear	UTSW	10	77886439	nonsense	probably null
R4010:Tspear	UTSW	10	77836476	intron	probably benign
R4661:Tspear	UTSW	10	77866329	missense	probably benign	0.24
R4789:Tspear	UTSW	10	77866365	missense	possibly damaging	0.63
R4804:Tspear	UTSW	10	77776957	splice site	probably null
R4904:Tspear	UTSW	10	77869655	missense	possibly damaging	0.93
R4937:Tspear	UTSW	10	77875043	missense	probably damaging	0.98
R4956:Tspear	UTSW	10	77864767	missense	possibly damaging	0.86
R5590:Tspear	UTSW	10	77870365	missense	probably benign
R6344:Tspear	UTSW	10	77875013	missense	possibly damaging	0.95
R6629:Tspear	UTSW	10	77870509	missense	probably benign	0.08
R7611:Tspear	UTSW	10	77881215	missense	probably benign	0.01
R8507:Tspear	UTSW	10	77875064	missense	probably benign	0.01
R8811:Tspear	UTSW	10	77829629	missense	probably benign	0.08
R8856:Tspear	UTSW	10	77829637	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTCTCCAGTTAGGACCACC -3'
(R):5'- ATGGTCAATCACTGGGACGC -3'

Sequencing Primer
(F):5'- AGTTAGGACCACCCTCCTC -3'
(R):5'- TACCTACATGTCCACCGGGAG -3'

Posted On

2015-11-11