Incidental Mutation 'R6629:Tspear'
ID524997
Institutional Source Beutler Lab
Gene Symbol Tspear
Ensembl Gene ENSMUSG00000069581
Gene Namethrombospondin type laminin G domain and EAR repeats
SynonymsC330046G03Rik, ORF65
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6629 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77686569-77887021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77870509 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 371 (H371L)
Ref Sequence ENSEMBL: ENSMUSP00000090020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092366]
Predicted Effect probably benign
Transcript: ENSMUST00000092366
AA Change: H371L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581
AA Change: H371L

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092368
SMART Domains Protein: ENSMUSP00000090022
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
TSPN 3 174 2.24e-5 SMART
LamG 34 173 1.09e-1 SMART
low complexity region 293 303 N/A INTRINSIC
Pfam:EPTP 311 357 3.4e-20 PFAM
Pfam:EPTP 362 409 4.9e-23 PFAM
Pfam:EPTP 414 461 3.1e-15 PFAM
Pfam:EPTP 464 519 2.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125241
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,780 S219P possibly damaging Het
Atxn3 A T 12: 101,937,406 M180K probably benign Het
Bnip2 G T 9: 70,002,111 R236L probably null Het
Boc T C 16: 44,492,361 D582G probably benign Het
Cacul1 T C 19: 60,580,367 S118G probably benign Het
Cpa2 A T 6: 30,554,194 D271V probably damaging Het
Cubn G A 2: 13,430,872 T1091M probably damaging Het
Dlgap2 A G 8: 14,831,465 T846A probably benign Het
Eif5 G T 12: 111,543,608 A329S probably damaging Het
Fam136b-ps G A 15: 31,276,816 probably benign Het
Gnrhr A G 5: 86,182,309 V284A probably benign Het
Grin3a A G 4: 49,844,991 S31P probably damaging Het
Hectd2 T C 19: 36,615,538 L701P probably damaging Het
Hook1 C T 4: 96,001,270 T241I probably benign Het
Kif5a A G 10: 127,248,254 V52A probably damaging Het
Lasp1 T A 11: 97,806,896 Y11* probably null Het
Meltf A G 16: 31,885,076 Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,841,267 probably benign Het
Nek1 A G 8: 61,054,333 probably null Het
Notch2 C A 3: 98,120,881 N969K possibly damaging Het
Olfr1221 T A 2: 89,112,162 M117L probably benign Het
Pcnx2 C T 8: 125,891,112 G135R probably benign Het
Pla2g4f A T 2: 120,308,242 L242Q probably damaging Het
Plcxd2 T G 16: 45,965,107 T312P probably damaging Het
Prpf4 G A 4: 62,417,860 V275I possibly damaging Het
Prpf8 G A 11: 75,495,426 probably null Het
Pxn T C 5: 115,554,062 L401P probably damaging Het
Rab44 A T 17: 29,135,780 probably benign Het
Rfx6 C A 10: 51,725,490 T669K probably benign Het
Rgs16 A G 1: 153,743,674 N142S probably damaging Het
Rhobtb1 A G 10: 69,270,316 E237G possibly damaging Het
Rsbn1 A C 3: 103,928,441 D265A probably damaging Het
Rufy4 A G 1: 74,132,367 probably null Het
Slc4a1 C A 11: 102,361,222 E19* probably null Het
Tctn1 A G 5: 122,242,668 S526P probably damaging Het
Vmn1r34 A T 6: 66,637,515 F80I probably benign Het
Wdr75 G A 1: 45,812,056 S264N probably damaging Het
Zfp652 A T 11: 95,763,790 N340Y probably damaging Het
Zp3 A G 5: 135,987,336 T306A probably benign Het
Other mutations in Tspear
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tspear APN 10 77873236 missense probably benign 0.30
IGL01726:Tspear APN 10 77881287 intron probably benign
IGL02244:Tspear APN 10 77852856 unclassified probably benign
IGL02393:Tspear APN 10 77836573 missense probably damaging 1.00
IGL02502:Tspear APN 10 77852958 intron probably benign
IGL02653:Tspear APN 10 77706965 utr 3 prime probably benign
IGL03345:Tspear APN 10 77874882 splice site probably null
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0542:Tspear UTSW 10 77881087 missense probably benign 0.14
R1384:Tspear UTSW 10 77866332 missense probably benign 0.44
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1545:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1625:Tspear UTSW 10 77870499 missense probably benign 0.20
R1635:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1636:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1637:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1744:Tspear UTSW 10 77864884 unclassified probably null
R1749:Tspear UTSW 10 77869673 missense probably benign 0.00
R1768:Tspear UTSW 10 77875116 critical splice donor site probably null
R1774:Tspear UTSW 10 77873185 missense probably benign 0.01
R1791:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1892:Tspear UTSW 10 77870474 missense probably benign 0.00
R2014:Tspear UTSW 10 77875120 splice site probably benign
R2108:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R2248:Tspear UTSW 10 77873269 missense probably damaging 1.00
R3038:Tspear UTSW 10 77886439 nonsense probably null
R4010:Tspear UTSW 10 77836476 intron probably benign
R4661:Tspear UTSW 10 77866329 missense probably benign 0.24
R4734:Tspear UTSW 10 77864695 missense probably damaging 0.99
R4789:Tspear UTSW 10 77866365 missense possibly damaging 0.63
R4804:Tspear UTSW 10 77776957 unclassified probably null
R4904:Tspear UTSW 10 77869655 missense possibly damaging 0.93
R4937:Tspear UTSW 10 77875043 missense probably damaging 0.98
R4956:Tspear UTSW 10 77864767 missense possibly damaging 0.86
R5590:Tspear UTSW 10 77870365 missense probably benign
R6344:Tspear UTSW 10 77875013 missense possibly damaging 0.95
R7611:Tspear UTSW 10 77881215 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTATGCACACTGACTAGGTCC -3'
(R):5'- ACAGTCATCCCTCCTAGCAAGG -3'

Sequencing Primer
(F):5'- ACCAAGCTGGACTACGTTG -3'
(R):5'- TTTGACTTGCAGAGTGCG -3'
Posted On2018-06-22