Incidental Mutation 'R4738:Olfr376'
ID359450
Institutional Source Beutler Lab
Gene Symbol Olfr376
Ensembl Gene ENSMUSG00000063881
Gene Nameolfactory receptor 376
SynonymsGA_x6K02T2P1NL-3535075-3536028, MOR135-12
MMRRC Submission 041964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4738 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73371246-73377836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73375350 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 200 (L200F)
Ref Sequence ENSEMBL: ENSMUSP00000126073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078952] [ENSMUST00000120401] [ENSMUST00000127789] [ENSMUST00000170592]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078952
AA Change: L203F

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077977
Gene: ENSMUSG00000063881
AA Change: L203F

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 7.4e-8 PFAM
Pfam:7tm_1 47 296 2.7e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120401
AA Change: L200F

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113236
Gene: ENSMUSG00000063881
AA Change: L200F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 308 1.1e-7 PFAM
Pfam:7tm_1 44 293 7.2e-36 PFAM
Pfam:7tm_4 142 286 1.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127789
AA Change: L200F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000116228
Gene: ENSMUSG00000072709
AA Change: L200F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 231 7.3e-8 PFAM
Pfam:7tm_1 44 240 2.5e-33 PFAM
Pfam:7tm_4 142 249 4.5e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170592
AA Change: L200F

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126073
Gene: ENSMUSG00000063881
AA Change: L200F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 308 1.1e-7 PFAM
Pfam:7tm_1 44 293 7.2e-36 PFAM
Pfam:7tm_4 142 286 1.4e-46 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,973,983 I176T probably benign Het
Angpt2 C T 8: 18,741,059 D74N probably benign Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Areg T C 5: 91,146,724 I247T possibly damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Atp6v1b2 T A 8: 69,103,410 S246T probably benign Het
Atp8b1 T C 18: 64,545,180 R882G probably benign Het
Atp9a A G 2: 168,668,181 V444A probably benign Het
Babam2 T A 5: 31,901,142 Y211N probably damaging Het
Btbd11 C T 10: 85,627,248 Q626* probably null Het
Ccdc127 T G 13: 74,357,068 probably benign Het
Cep192 A T 18: 67,884,830 K2500* probably null Het
Cnot4 T C 6: 35,051,376 N435S probably benign Het
Col12a1 T C 9: 79,699,282 I620V probably damaging Het
Cyth4 G A 15: 78,605,874 M62I probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dchs1 C T 7: 105,758,673 R1984Q probably damaging Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Disp2 A G 2: 118,790,326 Y513C probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Eif3b T A 5: 140,430,078 M384K probably benign Het
Emc1 G T 4: 139,362,202 G227V possibly damaging Het
Eri2 A G 7: 119,787,732 probably null Het
Frzb A G 2: 80,424,597 probably null Het
Ganc T A 2: 120,452,594 V743D probably damaging Het
Gfpt1 C A 6: 87,054,747 probably benign Het
Gm3086 A T 12: 69,969,381 probably benign Het
Gsdmc2 A T 15: 63,826,801 Y315* probably null Het
Haus6 A G 4: 86,600,749 probably null Het
Hhip C T 8: 79,992,570 D443N probably damaging Het
Isg15 T C 4: 156,199,862 M70V probably benign Het
Kank2 T C 9: 21,774,619 N653S probably damaging Het
Klhdc1 G T 12: 69,283,133 R345S probably benign Het
Larp7 A G 3: 127,546,045 probably null Het
Lgals12 A G 19: 7,604,099 V81A probably benign Het
Lhx9 A G 1: 138,832,748 L288P probably damaging Het
Mcpt9 T A 14: 56,026,999 H213L probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Neb A C 2: 52,187,482 S1846A probably damaging Het
Nr3c2 T C 8: 76,909,307 S346P possibly damaging Het
Olfr1564 A G 17: 33,215,810 F178S probably benign Het
Olfr187 T C 16: 59,036,195 I181V probably benign Het
Olfr487 A T 7: 108,211,994 N178K probably damaging Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Osbpl10 A G 9: 115,216,574 E426G probably damaging Het
Ovgp1 T C 3: 105,979,918 V210A probably damaging Het
Pam A T 1: 97,923,132 V167D probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pbx4 C T 8: 69,864,969 T201M probably damaging Het
Pcdhb9 T C 18: 37,403,415 C821R probably benign Het
Plekhg3 T C 12: 76,576,914 I976T probably damaging Het
Pold1 G A 7: 44,541,329 R304C probably damaging Het
Prss38 T C 11: 59,372,945 T314A probably benign Het
Psph T C 5: 129,769,386 probably null Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rab3gap1 A G 1: 127,934,436 E648G probably damaging Het
Ralgds A G 2: 28,545,416 E465G probably damaging Het
Rfng T C 11: 120,783,964 T67A probably damaging Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Rps6kl1 G T 12: 85,140,387 F181L probably benign Het
Spata46 G A 1: 170,311,886 M151I possibly damaging Het
Ssbp1 T A 6: 40,477,980 N124K probably damaging Het
Sspo C T 6: 48,478,396 A3064V possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tdpoz4 T C 3: 93,797,089 I231T probably damaging Het
Tff3 G A 17: 31,127,509 P30S probably benign Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tlk2 T A 11: 105,256,882 H369Q probably benign Het
Tnfaip8 A G 18: 50,090,502 T14A probably damaging Het
Tspan17 T A 13: 54,795,064 C116* probably null Het
Ttn T C 2: 76,880,546 probably benign Het
Tyr T C 7: 87,492,647 Y158C probably null Het
U2af1l4 G T 7: 30,563,348 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r86 T A 10: 130,447,070 D559V probably damaging Het
Wfikkn2 T A 11: 94,239,076 T80S probably benign Het
Zdhhc2 T A 8: 40,464,142 probably null Het
Zfp521 T C 18: 13,844,054 K1101E possibly damaging Het
Zfp595 A T 13: 67,317,165 F345I probably benign Het
Zswim2 T A 2: 83,915,395 R566S probably benign Het
Other mutations in Olfr376
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr376 APN 11 73375007 missense probably benign 0.03
IGL01462:Olfr376 APN 11 73374752 start codon destroyed probably null 0.02
IGL01725:Olfr376 APN 11 73375156 missense probably benign 0.39
IGL02225:Olfr376 APN 11 73375078 missense probably damaging 0.98
R0006:Olfr376 UTSW 11 73375588 missense possibly damaging 0.65
R0090:Olfr376 UTSW 11 73375576 missense probably benign 0.04
R0743:Olfr376 UTSW 11 73374889 missense probably benign 0.03
R0884:Olfr376 UTSW 11 73374889 missense probably benign 0.03
R1102:Olfr376 UTSW 11 73374874 missense probably benign 0.00
R1582:Olfr376 UTSW 11 73375264 missense probably damaging 1.00
R1765:Olfr376 UTSW 11 73375344 missense probably damaging 1.00
R1929:Olfr376 UTSW 11 73375601 missense probably damaging 1.00
R1941:Olfr376 UTSW 11 73375621 missense probably damaging 1.00
R4947:Olfr376 UTSW 11 73375417 nonsense probably null
R5837:Olfr376 UTSW 11 73375648 missense probably benign 0.02
R6440:Olfr376 UTSW 11 73375347 missense probably benign 0.06
R6736:Olfr376 UTSW 11 73375576 missense probably benign 0.18
R7254:Olfr376 UTSW 11 73375375 missense probably benign
R7354:Olfr376 UTSW 11 73375375 missense probably benign 0.01
R7437:Olfr376 UTSW 11 73375018 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGAGCATCATGAGCCCCAG -3'
(R):5'- AGTAGAGTTATCAGCTGATGGAC -3'

Sequencing Primer
(F):5'- CCCCAGGCTCTGTGTGAG -3'
(R):5'- GTACAGACCAATGACTGTTCCATAG -3'
Posted On2015-11-11