Incidental Mutation 'R4789:Coro7'
ID367357
Institutional Source Beutler Lab
Gene Symbol Coro7
Ensembl Gene ENSMUSG00000039637
Gene Namecoronin 7
Synonyms0610011B16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4789 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4626133-4679777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4628221 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 880 (Y880C)
Ref Sequence ENSEMBL: ENSMUSP00000048489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014445] [ENSMUST00000038552] [ENSMUST00000135823] [ENSMUST00000156889]
Predicted Effect probably benign
Transcript: ENSMUST00000014445
SMART Domains Protein: ENSMUSP00000014445
Gene: ENSMUSG00000014301

DomainStartEndE-ValueType
Pfam:Pam16 1 125 4.9e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038552
AA Change: Y880C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637
AA Change: Y880C

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127120
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151156
Predicted Effect probably benign
Transcript: ENSMUST00000156889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229767
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit disruption of the Golgi apparatus. Mutant fibroblasts show increased cell spreading and cellular F-actin content, increased cell polarization and migration, and enhanced wound healing in a scratch-wound assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Add2 G A 6: 86,118,770 V475M probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Bok T C 1: 93,689,241 V103A probably damaging Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dlat A T 9: 50,659,370 C33S probably benign Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Dock10 T A 1: 80,541,281 H1241L probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Fdxacb1 A G 9: 50,770,118 D113G possibly damaging Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Thbs2 C T 17: 14,671,488 G929D probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Triobp A G 15: 78,991,028 D137G probably damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Zkscan14 T A 5: 145,195,634 K362N probably damaging Het
Other mutations in Coro7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Coro7 APN 16 4634636 missense possibly damaging 0.83
IGL00885:Coro7 APN 16 4635026 missense probably benign 0.00
IGL02944:Coro7 APN 16 4635412 missense probably benign 0.14
IGL03104:Coro7 APN 16 4629126 missense probably damaging 1.00
IGL03153:Coro7 APN 16 4635382 critical splice donor site probably null
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0080:Coro7 UTSW 16 4630464 missense probably damaging 1.00
R0193:Coro7 UTSW 16 4627504 unclassified probably benign
R0242:Coro7 UTSW 16 4630178 splice site probably benign
R0318:Coro7 UTSW 16 4675807 missense probably benign 0.09
R0554:Coro7 UTSW 16 4632257 missense possibly damaging 0.63
R0666:Coro7 UTSW 16 4631911 missense possibly damaging 0.70
R0835:Coro7 UTSW 16 4632254 missense probably benign 0.12
R0968:Coro7 UTSW 16 4670055 splice site probably benign
R1670:Coro7 UTSW 16 4628233 missense possibly damaging 0.76
R1709:Coro7 UTSW 16 4634441 splice site probably null
R1848:Coro7 UTSW 16 4630434 missense probably damaging 0.99
R1884:Coro7 UTSW 16 4628819 unclassified probably benign
R1935:Coro7 UTSW 16 4628732 missense probably benign
R1937:Coro7 UTSW 16 4628732 missense probably benign
R1939:Coro7 UTSW 16 4628732 missense probably benign
R1967:Coro7 UTSW 16 4634889 missense probably damaging 1.00
R1969:Coro7 UTSW 16 4633756 missense probably benign 0.19
R1970:Coro7 UTSW 16 4633756 missense probably benign 0.19
R3034:Coro7 UTSW 16 4632291 missense probably damaging 0.99
R4638:Coro7 UTSW 16 4632287 missense probably damaging 0.96
R4710:Coro7 UTSW 16 4634933 intron probably benign
R4723:Coro7 UTSW 16 4631994 missense probably benign 0.00
R5493:Coro7 UTSW 16 4632487 missense probably damaging 0.99
R5619:Coro7 UTSW 16 4676935 critical splice donor site probably null
R5756:Coro7 UTSW 16 4632284 missense probably damaging 0.97
R5974:Coro7 UTSW 16 4631889 missense possibly damaging 0.83
R6010:Coro7 UTSW 16 4669956 missense possibly damaging 0.68
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6906:Coro7 UTSW 16 4633304 missense probably benign 0.00
R6925:Coro7 UTSW 16 4628674 critical splice donor site probably null
R7069:Coro7 UTSW 16 4679611 start codon destroyed probably damaging 0.99
R7326:Coro7 UTSW 16 4632048 missense probably damaging 0.96
R7421:Coro7 UTSW 16 4668751 missense probably benign 0.19
R7521:Coro7 UTSW 16 4631482 missense probably benign 0.00
R7773:Coro7 UTSW 16 4632006 missense probably damaging 1.00
R7846:Coro7 UTSW 16 4670536 missense probably damaging 1.00
R7929:Coro7 UTSW 16 4670536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCAAGGGCTTAGGTCTTC -3'
(R):5'- GGTGAACAGGGGCTTTAATAAC -3'

Sequencing Primer
(F):5'- TGTGACTCCCTACCCAGAG -3'
(R):5'- CAGGGGCTTTAATAACTTGTTAATGC -3'
Posted On2015-12-29