Incidental Mutation 'R0835:Coro7'
ID77855
Institutional Source Beutler Lab
Gene Symbol Coro7
Ensembl Gene ENSMUSG00000039637
Gene Namecoronin 7
Synonyms0610011B16Rik
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0835 (G1)
Quality Score139
Status Not validated
Chromosome16
Chromosomal Location4626133-4679777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4632254 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 577 (E577G)
Ref Sequence ENSEMBL: ENSMUSP00000048489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000135823]
Predicted Effect probably benign
Transcript: ENSMUST00000038552
AA Change: E577G

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637
AA Change: E577G

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130125
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151156
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit disruption of the Golgi apparatus. Mutant fibroblasts show increased cell spreading and cellular F-actin content, increased cell polarization and migration, and enhanced wound healing in a scratch-wound assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Coro7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Coro7 APN 16 4634636 missense possibly damaging 0.83
IGL00885:Coro7 APN 16 4635026 missense probably benign 0.00
IGL02944:Coro7 APN 16 4635412 missense probably benign 0.14
IGL03104:Coro7 APN 16 4629126 missense probably damaging 1.00
IGL03153:Coro7 APN 16 4635382 critical splice donor site probably null
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0080:Coro7 UTSW 16 4630464 missense probably damaging 1.00
R0193:Coro7 UTSW 16 4627504 unclassified probably benign
R0242:Coro7 UTSW 16 4630178 splice site probably benign
R0318:Coro7 UTSW 16 4675807 missense probably benign 0.09
R0554:Coro7 UTSW 16 4632257 missense possibly damaging 0.63
R0666:Coro7 UTSW 16 4631911 missense possibly damaging 0.70
R0968:Coro7 UTSW 16 4670055 splice site probably benign
R1670:Coro7 UTSW 16 4628233 missense possibly damaging 0.76
R1709:Coro7 UTSW 16 4634441 splice site probably null
R1848:Coro7 UTSW 16 4630434 missense probably damaging 0.99
R1884:Coro7 UTSW 16 4628819 unclassified probably benign
R1935:Coro7 UTSW 16 4628732 missense probably benign
R1937:Coro7 UTSW 16 4628732 missense probably benign
R1939:Coro7 UTSW 16 4628732 missense probably benign
R1967:Coro7 UTSW 16 4634889 missense probably damaging 1.00
R1969:Coro7 UTSW 16 4633756 missense probably benign 0.19
R1970:Coro7 UTSW 16 4633756 missense probably benign 0.19
R3034:Coro7 UTSW 16 4632291 missense probably damaging 0.99
R4638:Coro7 UTSW 16 4632287 missense probably damaging 0.96
R4710:Coro7 UTSW 16 4634933 intron probably benign
R4723:Coro7 UTSW 16 4631994 missense probably benign 0.00
R4789:Coro7 UTSW 16 4628221 missense probably damaging 1.00
R5493:Coro7 UTSW 16 4632487 missense probably damaging 0.99
R5619:Coro7 UTSW 16 4676935 critical splice donor site probably null
R5756:Coro7 UTSW 16 4632284 missense probably damaging 0.97
R5974:Coro7 UTSW 16 4631889 missense possibly damaging 0.83
R6010:Coro7 UTSW 16 4669956 missense possibly damaging 0.68
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6906:Coro7 UTSW 16 4633304 missense probably benign 0.00
R6925:Coro7 UTSW 16 4628674 critical splice donor site probably null
R7069:Coro7 UTSW 16 4679611 start codon destroyed probably damaging 0.99
R7326:Coro7 UTSW 16 4632048 missense probably damaging 0.96
R7421:Coro7 UTSW 16 4668751 missense probably benign 0.19
R7521:Coro7 UTSW 16 4631482 missense probably benign 0.00
R7773:Coro7 UTSW 16 4632006 missense probably damaging 1.00
R7846:Coro7 UTSW 16 4670536 missense probably damaging 1.00
R7929:Coro7 UTSW 16 4670536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGAAGGTCCCAGATGCGAAC -3'
(R):5'- TGCCTGACACAGCATTGCCTAC -3'

Sequencing Primer
(F):5'- TCCCAGATGCGAACGGTTAG -3'
(R):5'- TTGCCTACACTTCAGAATGGGAC -3'
Posted On2013-10-16