Incidental Mutation 'R4844:Cyp7a1'
ID372036
Institutional Source Beutler Lab
Gene Symbol Cyp7a1
Ensembl Gene ENSMUSG00000028240
Gene Namecytochrome P450, family 7, subfamily a, polypeptide 1
Synonymscholesterol 7 alpha hydroxylase
MMRRC Submission 042457-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R4844 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location6265612-6275633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6273655 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 84 (S84P)
Ref Sequence ENSEMBL: ENSMUSP00000029905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029905]
Predicted Effect probably damaging
Transcript: ENSMUST00000029905
AA Change: S84P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029905
Gene: ENSMUSG00000028240
AA Change: S84P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 32 497 2.3e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147346
Meta Mutation Damage Score 0.6684 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway in the liver, which converts cholesterol to bile acids. This reaction is the rate limiting step and the major site of regulation of bile acid synthesis, which is the primary mechanism for the removal of cholesterol from the body. Polymorphisms in the promoter of this gene are associated with defects in bile acid synthesis. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for disruption of this gene experience severe neonatal and postnatal lethality. Supplementation of the maternal diet with fat soluble vitamins and cholic acid starting before birth alleviates much of the phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,213,565 V31A possibly damaging Het
Abcc9 T C 6: 142,689,098 T147A probably benign Het
Acvrl1 T C 15: 101,135,528 S99P probably damaging Het
Adamts3 T A 5: 89,677,816 S1055C probably damaging Het
Aftph T C 11: 20,708,667 probably benign Het
Aldh1a1 A G 19: 20,634,400 K363E probably benign Het
Astn2 A G 4: 65,644,730 V886A possibly damaging Het
Atad5 G A 11: 80,114,311 probably null Het
Ccnf G T 17: 24,230,357 Y482* probably null Het
Cfap97 A G 8: 46,169,675 D34G possibly damaging Het
Chst11 G T 10: 83,191,089 E117* probably null Het
Cobl A T 11: 12,254,740 L572Q probably benign Het
Coch G A 12: 51,602,694 G263S probably damaging Het
Coq4 T C 2: 29,796,014 I205T possibly damaging Het
Cyp3a13 A T 5: 137,917,551 I62K probably benign Het
Fam45a GTCT GT 19: 60,834,997 probably null Het
G6pc3 G A 11: 102,193,231 probably null Het
Gm10576 T C 4: 101,054,510 noncoding transcript Het
Gm17511 G A 7: 127,286,282 noncoding transcript Het
Gnat2 T C 3: 108,095,515 S80P probably damaging Het
Gpaa1 C T 15: 76,332,308 probably benign Het
Gpr107 T A 2: 31,188,674 probably null Het
Hormad1 T C 3: 95,570,931 Y103H probably damaging Het
Ighv14-1 T G 12: 113,932,002 Q101P probably damaging Het
Igsf9 A G 1: 172,497,170 D885G probably benign Het
Il15ra G A 2: 11,718,271 probably benign Het
Islr2 C T 9: 58,208,234 probably benign Het
Jak3 A T 8: 71,681,655 N467I possibly damaging Het
Jarid2 T C 13: 44,913,772 V1023A probably damaging Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2c T C 5: 25,315,113 T2000A probably benign Het
Lpxn A G 19: 12,833,172 T327A probably damaging Het
Mxra8 A G 4: 155,842,694 T362A probably benign Het
Myh6 A G 14: 54,947,194 I1560T possibly damaging Het
Ndufv1 A G 19: 4,012,574 S17P probably benign Het
Nwd1 A T 8: 72,667,114 H335L probably damaging Het
Olfr38 T A 6: 42,762,460 M136K probably damaging Het
Olfr403 A G 11: 74,196,076 D191G probably damaging Het
Otop2 G A 11: 115,323,375 probably null Het
Pwwp2b C A 7: 139,255,586 S314R probably benign Het
Rfx7 C T 9: 72,593,242 Q95* probably null Het
Serpine2 A T 1: 79,799,524 L192* probably null Het
Smpdl3b T C 4: 132,738,058 I322M probably damaging Het
Spata31d1b C T 13: 59,718,355 R1106C possibly damaging Het
Sprr2k T G 3: 92,429,425 probably null Het
St8sia1 T A 6: 142,829,270 R194S possibly damaging Het
Sv2a T A 3: 96,188,379 V337D probably damaging Het
Tars G A 15: 11,385,195 R637W possibly damaging Het
Tcp11l2 G T 10: 84,613,691 V507L probably benign Het
Tpr T C 1: 150,445,879 Y2262H possibly damaging Het
Vars A G 17: 35,011,612 E529G probably damaging Het
Vash2 C T 1: 190,978,494 probably benign Het
Vmn1r194 T C 13: 22,245,053 V280A probably benign Het
Vti1a A G 19: 55,391,865 T142A probably damaging Het
Zfp111 C T 7: 24,199,376 C270Y probably damaging Het
Zfp518a T A 19: 40,914,896 Y1090N probably damaging Het
Zfp616 A T 11: 74,084,399 Y498F probably benign Het
Other mutations in Cyp7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Cyp7a1 APN 4 6275517 missense probably damaging 1.00
IGL01577:Cyp7a1 APN 4 6273618 missense probably damaging 1.00
IGL01723:Cyp7a1 APN 4 6272442 missense probably damaging 1.00
IGL02602:Cyp7a1 APN 4 6272871 missense possibly damaging 0.88
IGL03302:Cyp7a1 APN 4 6273801 missense probably benign 0.05
R1017:Cyp7a1 UTSW 4 6272307 missense probably damaging 1.00
R1737:Cyp7a1 UTSW 4 6272848 missense probably benign 0.00
R2044:Cyp7a1 UTSW 4 6275492 missense probably null 1.00
R2326:Cyp7a1 UTSW 4 6268396 missense probably benign
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R3438:Cyp7a1 UTSW 4 6272769 missense probably damaging 1.00
R4181:Cyp7a1 UTSW 4 6271205 missense probably benign 0.09
R5184:Cyp7a1 UTSW 4 6271207 missense probably benign
R5371:Cyp7a1 UTSW 4 6268378 missense probably damaging 1.00
R5613:Cyp7a1 UTSW 4 6272799 missense probably damaging 1.00
R5682:Cyp7a1 UTSW 4 6268429 missense probably benign 0.28
R5987:Cyp7a1 UTSW 4 6268476 missense probably benign 0.05
R5995:Cyp7a1 UTSW 4 6272371 missense possibly damaging 0.74
R6128:Cyp7a1 UTSW 4 6272788 missense possibly damaging 0.80
R6552:Cyp7a1 UTSW 4 6272361 nonsense probably null
R6860:Cyp7a1 UTSW 4 6272587 missense probably damaging 1.00
R7032:Cyp7a1 UTSW 4 6268463 missense possibly damaging 0.94
R7631:Cyp7a1 UTSW 4 6272763 missense possibly damaging 0.89
R7884:Cyp7a1 UTSW 4 6272697 missense probably benign 0.04
R7967:Cyp7a1 UTSW 4 6272697 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCATGCAGTGTCCTCTGTCG -3'
(R):5'- TTACAGGAAAGTAGGTGAACCTC -3'

Sequencing Primer
(F):5'- CAGTGTCCTCTGTCGCAGAAATAATC -3'
(R):5'- GTAGGTGAACCTCCTTTGGACAAC -3'
Posted On2016-03-01