Incidental Mutation 'R4844:Nwd1'
ID372054
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene NameNACHT and WD repeat domain containing 1
SynonymsA230063L24Rik
MMRRC Submission 042457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R4844 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72646711-72717876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72667114 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 335 (H335L)
Ref Sequence ENSEMBL: ENSMUSP00000124804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
Predicted Effect probably damaging
Transcript: ENSMUST00000093427
AA Change: H335L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: H335L

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably damaging
Transcript: ENSMUST00000161254
AA Change: H335L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: H335L

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161386
SMART Domains Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 1.2e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 984 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect possibly damaging
Transcript: ENSMUST00000228312
AA Change: H376L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.1642 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,213,565 V31A possibly damaging Het
Abcc9 T C 6: 142,689,098 T147A probably benign Het
Acvrl1 T C 15: 101,135,528 S99P probably damaging Het
Adamts3 T A 5: 89,677,816 S1055C probably damaging Het
Aftph T C 11: 20,708,667 probably benign Het
Aldh1a1 A G 19: 20,634,400 K363E probably benign Het
Astn2 A G 4: 65,644,730 V886A possibly damaging Het
Atad5 G A 11: 80,114,311 probably null Het
Ccnf G T 17: 24,230,357 Y482* probably null Het
Cfap97 A G 8: 46,169,675 D34G possibly damaging Het
Chst11 G T 10: 83,191,089 E117* probably null Het
Cobl A T 11: 12,254,740 L572Q probably benign Het
Coch G A 12: 51,602,694 G263S probably damaging Het
Coq4 T C 2: 29,796,014 I205T possibly damaging Het
Cyp3a13 A T 5: 137,917,551 I62K probably benign Het
Cyp7a1 A G 4: 6,273,655 S84P probably damaging Het
Fam45a GTCT GT 19: 60,834,997 probably null Het
G6pc3 G A 11: 102,193,231 probably null Het
Gm10576 T C 4: 101,054,510 noncoding transcript Het
Gm17511 G A 7: 127,286,282 noncoding transcript Het
Gnat2 T C 3: 108,095,515 S80P probably damaging Het
Gpaa1 C T 15: 76,332,308 probably benign Het
Gpr107 T A 2: 31,188,674 probably null Het
Hormad1 T C 3: 95,570,931 Y103H probably damaging Het
Ighv14-1 T G 12: 113,932,002 Q101P probably damaging Het
Igsf9 A G 1: 172,497,170 D885G probably benign Het
Il15ra G A 2: 11,718,271 probably benign Het
Islr2 C T 9: 58,208,234 probably benign Het
Jak3 A T 8: 71,681,655 N467I possibly damaging Het
Jarid2 T C 13: 44,913,772 V1023A probably damaging Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2c T C 5: 25,315,113 T2000A probably benign Het
Lpxn A G 19: 12,833,172 T327A probably damaging Het
Mxra8 A G 4: 155,842,694 T362A probably benign Het
Myh6 A G 14: 54,947,194 I1560T possibly damaging Het
Ndufv1 A G 19: 4,012,574 S17P probably benign Het
Olfr38 T A 6: 42,762,460 M136K probably damaging Het
Olfr403 A G 11: 74,196,076 D191G probably damaging Het
Otop2 G A 11: 115,323,375 probably null Het
Pwwp2b C A 7: 139,255,586 S314R probably benign Het
Rfx7 C T 9: 72,593,242 Q95* probably null Het
Serpine2 A T 1: 79,799,524 L192* probably null Het
Smpdl3b T C 4: 132,738,058 I322M probably damaging Het
Spata31d1b C T 13: 59,718,355 R1106C possibly damaging Het
Sprr2k T G 3: 92,429,425 probably null Het
St8sia1 T A 6: 142,829,270 R194S possibly damaging Het
Sv2a T A 3: 96,188,379 V337D probably damaging Het
Tars G A 15: 11,385,195 R637W possibly damaging Het
Tcp11l2 G T 10: 84,613,691 V507L probably benign Het
Tpr T C 1: 150,445,879 Y2262H possibly damaging Het
Vars A G 17: 35,011,612 E529G probably damaging Het
Vash2 C T 1: 190,978,494 probably benign Het
Vmn1r194 T C 13: 22,245,053 V280A probably benign Het
Vti1a A G 19: 55,391,865 T142A probably damaging Het
Zfp111 C T 7: 24,199,376 C270Y probably damaging Het
Zfp518a T A 19: 40,914,896 Y1090N probably damaging Het
Zfp616 A T 11: 74,084,399 Y498F probably benign Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 72671077 missense probably damaging 0.99
IGL01294:Nwd1 APN 8 72711745 missense probably damaging 1.00
IGL01298:Nwd1 APN 8 72662331 missense probably benign 0.00
IGL01333:Nwd1 APN 8 72666811 missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 72675115 missense probably damaging 1.00
IGL02244:Nwd1 APN 8 72707582 missense probably damaging 1.00
IGL02579:Nwd1 APN 8 72707527 missense probably damaging 1.00
IGL02608:Nwd1 APN 8 72667375 missense probably damaging 1.00
IGL02632:Nwd1 APN 8 72667454 missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 72667501 missense probably damaging 1.00
IGL03010:Nwd1 APN 8 72688060 splice site probably benign
R0017:Nwd1 UTSW 8 72709425 splice site probably benign
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0505:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0511:Nwd1 UTSW 8 72682005 missense probably damaging 1.00
R0612:Nwd1 UTSW 8 72667680 missense probably damaging 0.99
R0681:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0763:Nwd1 UTSW 8 72671044 missense probably damaging 1.00
R0905:Nwd1 UTSW 8 72709449 missense probably damaging 0.99
R1136:Nwd1 UTSW 8 72697769 splice site probably benign
R1483:Nwd1 UTSW 8 72657086 missense probably damaging 0.96
R1630:Nwd1 UTSW 8 72667029 missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 72711620 missense probably damaging 1.00
R1732:Nwd1 UTSW 8 72666835 missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 72704994 missense probably benign 0.00
R1973:Nwd1 UTSW 8 72704962 missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 72662427 missense probably benign
R2926:Nwd1 UTSW 8 72667012 missense probably damaging 1.00
R3706:Nwd1 UTSW 8 72667116 missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 72667811 nonsense probably null
R3917:Nwd1 UTSW 8 72667811 nonsense probably null
R4153:Nwd1 UTSW 8 72681936 missense probably damaging 1.00
R4426:Nwd1 UTSW 8 72666795 missense probably damaging 1.00
R4435:Nwd1 UTSW 8 72688136 missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 72670951 missense probably damaging 1.00
R4622:Nwd1 UTSW 8 72667300 missense probably damaging 1.00
R4659:Nwd1 UTSW 8 72695321 missense probably benign 0.03
R4694:Nwd1 UTSW 8 72667330 missense probably damaging 1.00
R4837:Nwd1 UTSW 8 72657131 missense probably damaging 1.00
R4906:Nwd1 UTSW 8 72672213 missense probably damaging 1.00
R5041:Nwd1 UTSW 8 72705055 missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 72671086 missense probably benign 0.07
R5416:Nwd1 UTSW 8 72666694 missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 72704976 missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5699:Nwd1 UTSW 8 72702974 critical splice donor site probably null
R5722:Nwd1 UTSW 8 72675244 missense probably damaging 0.97
R5762:Nwd1 UTSW 8 72670914 missense probably damaging 1.00
R5778:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5992:Nwd1 UTSW 8 72653573 critical splice donor site probably null
R6163:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6164:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6165:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6212:Nwd1 UTSW 8 72695322 missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 72662366 missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 72657062 missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 72682025 missense probably benign 0.27
R6944:Nwd1 UTSW 8 72653534 missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 72667660 missense probably damaging 1.00
R7060:Nwd1 UTSW 8 72666694 missense probably damaging 1.00
R7102:Nwd1 UTSW 8 72695329 missense probably damaging 1.00
R7265:Nwd1 UTSW 8 72692928 missense probably benign 0.29
R7343:Nwd1 UTSW 8 72711782 missense probably damaging 0.98
R7391:Nwd1 UTSW 8 72662418 missense probably damaging 0.99
R7424:Nwd1 UTSW 8 72675173 missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 72707830 missense probably benign 0.00
R7487:Nwd1 UTSW 8 72666638 missense unknown
R7502:Nwd1 UTSW 8 72707393 missense probably damaging 0.98
R7883:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
R7966:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
X0067:Nwd1 UTSW 8 72667256 missense possibly damaging 0.81
Z1176:Nwd1 UTSW 8 72672300 missense not run
Z1177:Nwd1 UTSW 8 72666628 missense probably damaging 0.97
Z1177:Nwd1 UTSW 8 72695387 missense possibly damaging 0.48
Z1177:Nwd1 UTSW 8 72709459 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTTACCTAAAGCAGTTGAGCG -3'
(R):5'- ACACTTGGAAGGACAGGCTC -3'

Sequencing Primer
(F):5'- GCAGTTGAGCGAGCAGTTC -3'
(R):5'- TCCTGAGGAGGCTGCGG -3'
Posted On2016-03-01